Hostname: page-component-848d4c4894-nmvwc Total loading time: 0 Render date: 2024-06-16T21:13:21.656Z Has data issue: false hasContentIssue false

Persistence of infectivity in elderly individuals diagnosed with severe acute respiratory coronavirus virus 2 (SARS-CoV-2) infection 10 days after onset of symptoms: A cross-sectional study

Published online by Cambridge University Press:  06 December 2021

Yves Longtin*
Affiliation:
Jewish General Hospital Sir Mortimer B. Davis, Montreal, Canada Lady Davis Research Institute, Montreal, Canada
Leighanne O. Parkes
Affiliation:
Jewish General Hospital Sir Mortimer B. Davis, Montreal, Canada
Hugues Charest
Affiliation:
Laboratoire de Santé Publique du Québec, Sainte-Anne-de-Bellevue, Canada Institut National de Santé Publique du Québec, Quebec City, Canada Département de microbiologie, infectiologie et immunologie, Faculté de médecine, Université de Montréal, Montréal, Canada
Stacy Rajarison
Affiliation:
Jewish General Hospital Sir Mortimer B. Davis, Montreal, Canada
Gerasimos J. Zaharatos
Affiliation:
Jewish General Hospital Sir Mortimer B. Davis, Montreal, Canada Lady Davis Research Institute, Montreal, Canada
Judith Fafard
Affiliation:
Laboratoire de Santé Publique du Québec, Sainte-Anne-de-Bellevue, Canada
Michel Roger
Affiliation:
Laboratoire de Santé Publique du Québec, Sainte-Anne-de-Bellevue, Canada
Gaston De Serres
Affiliation:
Institut National de Santé Publique du Québec, Quebec City, Canada
*
Author for correspondence: Dr Yves Longtin, E-mail: yves.longtin@mcgill.ca
Rights & Permissions [Opens in a new window]

Abstract

We performed viral culture of nasopharyngeal specimens in individuals aged 79 and older, infected with severe acute respiratory coronavirus virus 2 (SARS-CoV-2), 10 days after symptom onset. A positive viral culture was obtained in 10 (45%) of 22 participants, including 4 (33%) of 12 individuals with improving symptoms. The results of this small study suggest that infectivity may be prolonged among older individuals.

Type
Concise Communication
Creative Commons
Creative Common License - CCCreative Common License - BY
This is an Open Access article, distributed under the terms of the Creative Commons Attribution licence (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted re-use, distribution and reproduction, provided the original article is properly cited.
Copyright
© The Author(s), 2021. Published by Cambridge University Press on behalf of The Society for Healthcare Epidemiology of America

Coronavirus disease 2019 (COVID-19) is caused by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Reference Kadire, Fabre and Doctor1 Infected individuals must be placed under isolation precautions until infectivity is resolved. Reference Kadire, Fabre and Doctor1 The current recommendation is based on studies that used viral culture as an indicator of infectivity and requires isolation for 10 days for nonsevere infections in immunocompetent individuals, provided that symptoms are improving. Reference Kadire, Fabre and Doctor1,Reference Arons, Hatfield and Reddy2 However, these studies enrolled relatively young individuals and may not be generalizable to older patients. Reference Kadire, Fabre and Doctor1,Reference Gniazdowski, Morris and Wohl3,Reference Basile, McPhie and Carter4 Furthermore, some studies have reported a longer duration of SARS-CoV-2 RNA shedding by reverse transcription polymerase chain reaction (RT-PCR) among older patients. Reference Owusu, Pomeroy and Lewis5 We assessed the presence of infectious SARS-CoV-2 virus in elderly individuals with COVID-19, 10 days after symptom onset, using viral culture as a surrogate for infectivity.

Methods

Population and setting

In this prospective cross-sectional study, we included a convenience sample of unvaccinated individuals aged >79 years with COVID-19 confirmed by RT-PCR from 3 long-term care facilities and 1 acute-care institution in Montreal, Canada, between November 8, 2020, and January 25, 2021. Participants were identified using institutional infection control databases. Following verbal consent, a nasopharyngeal sample was collected on day 10 after symptom onset using a flocked swab (FLOQSwabs, Copan Italia, Brescia, Italy) and placed in 3 mL universal viral transport media (Copan Italia). The samples were kept at −80°C until RT-PCR and viral culture. Clinical data (ie, immunosupression, date of symptom onset, symptomatology, clinical outcomes) and the cycle threshold (Ct) value of the first positive RT-PCR were extracted from patient charts.

Laboratory methods

Viral cultures were performed on Vero E6 cells in 4-mL shell vials as previously described using a 0.1-mL aliquot of specimen as inoculum. Reference Longtin, Charest and Quach6 Cultures were kept for 15 days and monitored for a cytopathic effect (CPE) every other day.

On initial (day 0) samples, viral RNA was extracted using the MagMAX Viral/Pathogen II Nucleic Acid Isolation Kit (Thermo Scientific, Waltham MA). RT-PCR was performed on a LightCycler LC480 (Roche) using TaqPath RT-qPCR Master Mix (Thermo Scientific) and primers and probe targeting the E gene as described previously. Reference Corman, Landt and Kaiser7 Samples collected on day 10 and culture supernatants were processed with an in-house RT-PCR targeting the N gene as previously described. Reference Longtin, Charest and Quach6 We used the following forward, reverse and probe sequences: AACCAGAATGGAGAACGCAGTG, CGGTGAACCAAGACGCAGTATTAT and CGATCAAAACAACGTCGGCCCCAAGGTTTAC. Reference Longtin, Charest and Quach6

Table 1. Comparison of Patients With Positive or Negative Culture for SARS-CoV-2 on Day 10 of Infection

Note. Ct, cycle threshold; RT-PCR, reverse-transcription polymerase chain reaction; IQR, interquartile range.

1 Symptoms reported at least once during SARS-CoV-2 infection.

2 Includes lethargy (n=8), decreased appetite (n=6), weakness (n=3), diarrhea (n=3), nausea (n=1), confusion (n=1), hyperglycemia (n=1), hoarse voice (n=1), nasal congestion (n=1), wheezing (n=1), and syncope (n=1).

3 Defined as all of the following: resolution of fever by day 10, symptoms improving or completely resolved on day 10, absence of immunosuppression, absence of steroid use, absence of hospitalization.

4 Defined as fever on the day of testing or the preceding day.

5 n=17 (2 missing values).

6 2 samples had no SARS-CoV-2 detectable by RT-PCR and were excluded.

Statistical analyses

The primary outcome was culture positivity, defined as the detection of a CPE combined with a RT-PCR Ct value on the supernatant that is lower than the Ct value of the original specimen. To investigate factors associated with culture positivity, the Fisher exact test and the Mann-Whitney U test were performed as appropriate. To investigate the capacity of Ct value on day 10 to predict culture positivity, a receiver operating characteristics (ROC) curve was plotted to determine the probability of a true positive result as a function of the probability of a false positive result for all possible Ct values. A P <.05 was considered significant. The study was approved by the local research ethics committees.

Results

Overall, 22 participants were recruited. The median age was 90 years old (interquartile range [IQR], 86–96) and 12 (55%) were female (Table 1). Also, 4 patients (18%) were immunosuppressed, 13 (59%) received steroids to treat their infection, 8 (36%) were hospitalized, and 7 (32%) died. The initial sample to confirm the diagnosis was taken within 1 day of symptom onset in 21 (95%) of 22 and had a median RT-PCR Ct value of 21 (IQR, 16–27).

By day 10 after symptom onset, 8 (36%) of 22 had no residual symptom, 4 (18%) of 22 were still symptomatic but improving, whereas 10 (45%) of 22 had no symptom improvement. Specimens on day 10 had a median Ct of 21 (IQR, 16–24). A positive viral culture was obtained in 10 (45%) of 22 samples. Detection of a CPE occurred early; 6 (60%) of 10 samples demonstrated a CPE by incubation day 3, and 9 (90%) of 10 by incubation day 8.

A positive culture was obtained for 6 (60%) of 10 individuals whose symptoms were not improving on day 10 and for 4 (33%) of 12 of those with improving or resolved symptoms. Individuals with positive cultures tended to be more frequently hospitalized than culture-negative individuals: 5 (50%) of 10 versus 3 (25%) of 12, respectively. They were also more likely to have received steroids than those with negative cultures: 8 (80%) of 10 versus 5 (42%) of 12. However, individuals with positive cultures were less likely to die than those with negative cultures: 3 (30%) of 10 versus 4 (33%) of 12, respectively. Notably, these differences were not statistically significant. Among patients without a recognized risk factor for prolonged shedding, half (2 of 4) had a positive culture on day 10.

The Ct value of the initial sample did not predict culture positivity (median Ct of participants with and without a positive culture on day 10, 24 vs 21; P = .73) (Fig. 1). In contrast, the Ct value of the sample collected on day 10 predicted culture positivity (median Ct of positive vs negative cultures, 17 (IQR, 15–19) vs 23 (IQR, 21–26), respectively; P = .003). The performance of the day-10 Ct value in predicting culture positivity is shown through the receiver operating characteristics (ROC) curve (Supplementary Fig. 1 online). The area under the ROC curve was 0.90 (95% CI, 0.74–1.00). Using a cutoff Ct of 20.7 had 90% sensitivity (9 of 10 patients) and 90% specificity (9 of 10 patients) to predict culture positivity.

Fig. 1. Box plot showing the cycle threshold value of SARS-CoV-2 RT-PCR of nasopharyngeal swabs taken on the day of diagnosis and on day 10 after onset of symptoms from elderly patients infected with COVID-19, stratified by persistence of infectivity on day 10 after onset of symptoms. The horizontal line in each box indicates the median, whereas the top and bottom lines represent the 75th and 25th percentiles, respectively. Error bars represent 95% confidence intervals, and the dot represents an outlier.

Note. RT-PCR, detection of SARS-CoV-2 by reverse-transcription polymerase chain reaction.

Discussion

The belief that patients with COVID-19 remain infectious for <10 days stems from studies conducted among younger populations, with an average or median age ranging from 33 to 57. Reference Gniazdowski, Morris and Wohl3,Reference Basile, McPhie and Carter4 This notion may not be generalizable to patients over the age of 79; ∼50% of individuals in our study were still shedding infectious viral particles 10 days after symptom onset. Furthermore, clinical improvement was not predictive of loss of infectivity; ∼33% those with resolved or improving symptoms remained infective. In contrast, a lower cycle threshold (indicating a greater quantity of viral RNA in the sample) was a predictor of culture positivity on day 10 of COVID-19, as reported elsewhere. Reference Arons, Hatfield and Reddy2,Reference Gniazdowski, Morris and Wohl3,Reference Kim, Cui and Shin8

Few studies have investigated infectivity specifically among older individuals. In British long-term care homes, infectious virus could be recovered for up to 13 days among residents (median age, 85) compared to up to 7 days among staff (median age, 47). Reference Ladhani, Chow and Janarthanan9 Among nursing home residents in Washington, 4 of 8 samples collected between days 7 and 13 after symptom onset were positive by viral culture. Reference Arons, Hatfield and Reddy2 By contrast, recovery of replication-competent SARS-CoV-2 was 8 days or less after diagnosis in 8 of 9 nursing home residents in Arkansas, although infectivity persisted for 19 days in 1 immunocompromised individual. Reference Surie, Huang and Brown10

Our study has several limitations. The small sample size limits its generalizability. We did not collect data on comorbidities and other predictors of prolonged infectivity. Cultures were performed after a freeze–thaw cycle that may affect the integrity of the virus. We did not perform epidemiological investigations to correlate culture positivity and transmissibility to other individuals. Most individuals had risk factors for prolonged viral shedding. Still, persistent infectivity in our elderly population was much more frequent than previously reported among severe cases in younger individuals in which ∼5% remain infectious by day 10. Reference Kim, Cui and Shin8

In conclusion, this investigation suggests that infectivity may be longer than recognized among older individuals and appear to be predicted by low Ct values on day 10 of infection. Further studies are required to determine whether isolation precaution recommendations should be modified among the older individuals.

Supplementary material

To view supplementary material for this article, please visit https://doi.org/10.1017/ice.2021.502

Acknowledgments

We thank the microbiology technicians of the virology laboratory at the Laboratoire de Santé Publique du Québec for their assistance in conducting the viral cultures.

Financial support

Laboratoire de Santé Publique du Québec. Dr Yves Longtin’s research is supported by the Fonds de Recherche du Québec en Santé.

Conflicts of interest

Yves Longtin declares research grants outside of the submitted work from Merck, Gojo and Becton Dickinson. All other authors declare no competing interests.

References

Kadire, SR, Fabre, V, Doctor, Wenzel RP., how long should I isolate? N Engl J Med 2021;384:e47.CrossRefGoogle Scholar
Arons, MM, Hatfield, KM, Reddy, SC, et al. Presymptomatic SARS-CoV-2 infections and transmission in a skilled nursing facility. N Engl J Med 2020;382:20812090.CrossRefGoogle Scholar
Gniazdowski, V, Morris, CP, Wohl, S, et al. Repeat COVID-19 molecular testing: correlation of SARS-CoV-2 culture with molecular assays and cycle thresholds. Clin Infect Dis 2021;73:e860e869.CrossRefGoogle ScholarPubMed
Basile, K, McPhie, K, Carter, I, et al. Cell-based culture of SARS-CoV-2 informs infectivity and safe de-isolation assessments during COVID-19. Clin Infect Dis 2021;73:e2952e2959.CrossRefGoogle Scholar
Owusu, D, Pomeroy, MA, Lewis, NM, et al. Persistent SARS-CoV-2 RNA shedding without evidence of infectiousness: a cohort study of individuals with COVID-19. J Infect Dis 2021;224:13621371.CrossRefGoogle ScholarPubMed
Longtin, Y, Charest, H, Quach, C, et al. Infectivity of healthcare workers diagnosed with coronavirus disease 2019 (COVID-19) approximately 2 weeks after onset of symptoms: a cross-sectional study. Infect Control Hosp Epidemiol 2021. doi: 10.1017/ice.2020.1420.Google Scholar
Corman, VM, Landt, O, Kaiser, M, et al. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Euro Surveill 2020;25:2000045.CrossRefGoogle ScholarPubMed
Kim, MC, Cui, C, Shin, KR, et al. Duration of culturable SARS-CoV-2 in hospitalized patients with COVID-19. N Engl J Med 2021;384:671673.CrossRefGoogle ScholarPubMed
Ladhani, SN, Chow, JY, Janarthanan, R, et al. Investigation of SARS-CoV-2 outbreaks in six care homes in London, April 2020. EClinicalMedicine 2020;26:100533.CrossRefGoogle ScholarPubMed
Surie, D, Huang, JY, Brown, AC, et al. Infectious period of severe acute respiratory syndrome coronavirus 2 in 17 nursing home residents—Arkansas, June–August 2020. Open Forum Infect Dis 2021;8:ofab048.CrossRefGoogle Scholar
Figure 0

Table 1. Comparison of Patients With Positive or Negative Culture for SARS-CoV-2 on Day 10 of Infection

Figure 1

Fig. 1. Box plot showing the cycle threshold value of SARS-CoV-2 RT-PCR of nasopharyngeal swabs taken on the day of diagnosis and on day 10 after onset of symptoms from elderly patients infected with COVID-19, stratified by persistence of infectivity on day 10 after onset of symptoms. The horizontal line in each box indicates the median, whereas the top and bottom lines represent the 75th and 25th percentiles, respectively. Error bars represent 95% confidence intervals, and the dot represents an outlier.Note. RT-PCR, detection of SARS-CoV-2 by reverse-transcription polymerase chain reaction.

Supplementary material: PDF

Longtin et al. supplementary material

Figure S1

Download Longtin et al. supplementary material(PDF)
PDF 79 KB