INTRODUCTION
Human babesiosis is a zoonotic, malaria-like illness with variable clinical severity, ranging from asymptomatic disease in healthy adults to life-threatening outcomes in the elderly and asplenic or immunocompromised persons [Reference Homer1]. Over 100 Babesia species have been identified; however, only a few can infect humans. The majority of documented cases in the USA are attributed to B. microti infection, whereas most of the cases in Europe are caused by Babesia divergens infection [Reference Vannier and Krause2–Reference Leiby4]. In recent years, B. microti has increasingly been detected in rodents and ticks across Europe, Africa and Asia [Reference Hildebrandt5–Reference Saito-Ito11]. Babesia microti is gaining attention worldwide because of its wide distribution in endemic areas, the increased risk of causing human disease and the potential for transmission through blood transfusion. In China, human babesiosis has largely been overlooked due to the lack of medical awareness and clinical diagnostic methods [Reference Zhou12]. To date, only 10 human cases of infection by B. microti-like organisms have been recorded, mainly from Taiwan [Reference Shih13], Zhejiang province [Reference Yao14] and Yunnan province [Reference Zhou15, Reference Zhou16]. In natural foci areas, such as Heilongjiang, Jilin, Henan, Zhejiang, Fujian province, Inner Mongolia, Guangxi Zhuang and Xinjiang Uygur Autonomous Regions, Beijing and Taiwan, B. microti-like parasites have been identified in ticks and rodents [Reference Zhou12].
Yunnan province is located on the China–Myanmar border in southeastern China, where 83·3% of the national cases of B. microti infection have been recorded [Reference Zhou15, Reference Zhou16]. Yunnan province is the main area where malaria is endemic in China [Reference Zhou12]. Similarities in symptoms and the morphology of the causative agents of babesiosis and malaria can easily result in misdiagnosis [Reference Zhou17]. A recent report on the detection of both B. microti and plasmodium in this region has further highlighted the necessity of clinical identification and differential diagnosis of babesiosis and malaria by medical care workers. Field investigations are essential for determining the prevalence of B. microti in the natural foci of Yunnan province. The current lack of knowledge has hindered the development of informed prevention and control measures by the public health authorities. In this study, we performed field surveys to determine the extent of B. microti infection in wild rodents in Yunnan province, where abundant host species exist as potential reservoirs.
MATERIALS AND METHODS
Sample collection
Small wild rodents were collected from the following nine areas of the western Yunnan province: Heqing, Jianchuan, Lanping, Yunlong, Lianghe, Tengchong, Lancang, Menglian and Simao between 2009 and 2011 (Fig. 1 and Table 1). The sampling sites, according to the second national land survey, represent five land cover types: irrigated cropland, rainfed cropland, orchard, forest and shrubland. Altitudes in these regions ranged from 1500 to 3000 meters above sea level. The sampling sites were established on farmlands near the farmhouses where local residents are frequently exposed to wild rodents and ticks. Traps were set nightly at locations where rodent activity was observed and were recovered the next morning. Approximately 250–300 snap traps (baited with peanuts) were placed every night in lines of 20–50 traps at 10 m intervals. Species, age and sex of all captured rodents were identified and the carcasses were subsequently examined for ectoparasites before dissection. Samples were stored in liquid nitrogen until DNA extraction.
Geographic locations of captured wild rodents in Yunnan province.
The infection rates of Babesia microti in rodents captured from nine sampling sites in Yunnan province
DNA extraction
DNA was extracted from spleen tissues using the DNeasy Tissue Kit (QIAGEN, Germantown, MD, USA) following manufacturer's instructions. Negative controls were included throughout the process to exclude the possibility of contamination.
Polymerase chain reaction (PCR) amplification
PCR targeting a specific fragment of Babesia 18S rRNA gene was performed using the outer primers Bab 1 and Bab 4 and the inner primers Bab 2 and Bab 3, which amplified a 238 base pairs (bp) and a 154 bp fragments, respectively [Reference Persing18]. Both primary and nested PCR amplifications were performed in a 20 µl volume containing 2 µl of 10 × PCR buffer, 0·2 µl Taq DNA polymerase (5 U/μl), 0·2 µl dNTP mix (10 mM) (all from TaKaRa, Shuzo Co. Ltd, Kyoto, Japan), 15·8 µl deionised water, 1 µl DNA template and 0·4 µl of each primer (12·5 mM). DNA amplification was carried out under the following conditions: 94°C for 5 min; 35 cycles of 94°C for 30 s, 54°C for 30 s and 72°C for 30 s; followed by a final extension step at 72°C for 7 min. One microliter of the first-round PCR product was used in the second amplification. Conditions and systems used for the second amplification were identical to those used for the first round. For further confirmation, nested PCR was performed; a 1198 bp sequence of 18S rRNA gene was amplified using the specific primer pair B. microti 155F 5′– CTAGGGCTAATACATGCTCG –3′ and B microti 1606R 5′– ACTAGGCATTCCTCGTTCA –3′ for the initial amplification and the inner primer pair B. microti 255F 5′– AAATTAGCGAATCGCATGG –3′ and B. microti 1453R 5′– ACAGACCTGTTATTGCCTTAC –3′ for the nested PCR reaction. The conditions for both rounds of amplification were 94°C for 5 min; 40 cycles of 94°C for 30 s, 53°C for 40 s and 72°C for 1 min 30 s; followed by a final extension step at 72°C for 7 min.
Sequence analysis
Amplicons were sequenced in both directions by automated dideoxynucleotide cycle sequencing (ABI PRISM 377, PerkinElmer, Inc.). The 18S rRNA nucleotide sequences were used for phylogenetic analysis by Mega 5·1 software (http://mega.software.informer.com/5.1b/) based on the available GenBank nucleotide sequences (925 bp) from the USA, Japan and China [Reference Saito-Ito11, Reference Zhou16, Reference Sun19]. Babesia leo was used as an outgroup. Phylogenetic trees were constructed using the neighbor-joining algorithm method with the Kimura two-parameter model [Reference Kimura20]. Maximum parsimony analyses were conducted to examine the effect of the method used for analysis on the resulting phylogeny. Reliability of the phylogenetic analysis was estimated by bootstrap analysis with 1000 replications.
Statistical analysis
The prevalence of B. microti among rodent species and within various geographic locations was compared by χ 2 or the Fisher exact test. For each sampling site, the environmental factors, such as elevation and land use type, were determined using ArcGIS 9·3 software (ESRI Inc.). Poisson regression analysis was done to identify the risk factors for B. microti infection using STATA 10·0 software (StataCorp LP, College Station TX, USA). Significance level for all tests was set at P < 0·05.
RESULTS
A total of 1672 rodents comprising 4 orders were captured at nine locations during a 3-year survey. B. microti was detected in 72 (4·3%) rodents (Table 1) and the species Apodemus chevrieri exhibited the highest number of animals with B. microti infection (273, 16·3%) (Table 2). The 72 infected animals comprised 20 rodent species with B. microti infection rates ranging from 1·6% to 50% (Table 2). The infection rates were significantly higher in Apodemus chevrieri and Niviventer fulvescens than in any other species (χ 2 or the Fisher exact test, P = 0·018 and 0·023, respectively).
Detection rates of Babesia microti among wild rodent species in Yunnan Province
Rodents from all nine survey sites harbored B. microti at rates ranging from 0·6% to 17·4% (Table 1). The Lanping (20/115, 17·4%), Lianghe (11/141, 7·8%) and Tengchong regions (18/286, 6·3%) exhibited the highest rates, which increased significantly when Simao was used as a control site (odds ratios 33·26, 13·37 and 10·61, respectively; P < 0·05 for all) (Table 1). The infection rate was highest in shrub areas, followed by forests and rainfed cropland areas (Table 3). Using the Poisson regression model, we demonstrated that forests (P = 0·024) and shrublands (P = 0·003) had significantly higher rates of B. microti infection (Table 3). Variation in elevation had no discernible influence on the rates of detection (Table 4). Three B. microti variants were identified, including Yunnan-1 (GenBank accession number KC147722) in 49 rodents, Yunnan-2 (GenBank accession number KC147723) in 13 rodents and Yunnan-3 (GenBank accession number KC147724) in 10 rodents. Prevalence of the three B. microti variants differed significantly among the various rodent species, land use types and the sampling sites (Supplementary Tables 1, 2 and 3). Detection rates of Yunnan-1, Yunnan-2 and Yunnan-3 strains were highest in Rattus (11/49, 22·5%), Apodemus (10/13, 76·9%) and Crocidura (5/10, 50·0%), respectively. Yunnan-1 was more prevalent in forest areas (25/49, 51·0%), whereas the incidence of Yunnan-2 (4/13, 30·8%) and Yunnan-3 (4/10, 40·0%) infections were higher in rainfed croplands.
Comparison of Babesia microti infection rates in different land use types in Yunnan Province
The comparison among different land use types was made by Poisson analysis.
Poisson regression analysis of the environmental factors associated with detection of Babesia microti in wild rodents in Yunnan Province
* A continuous variable with the minimum interval of 30 m.
† Five kinds of land use types are rainfed cropland, irrigated cropland, orchard, shrubland and forest.
‡ Normalized difference vegetation index.
Phylogenetic analysis revealed that B microti sequences obtained in this study clustered with sequences from Japan and southeast China (Fig. 2). The Yunnan-1 sequence varied only by 1 bp from the Kobe-type sequences obtained from samples of a Japanese patient (AB 032434) and rodents in southeastern China (AB 241632). Using random basic local alignment search tool analysis of sequences in GenBank (http://blast.ncbi.nlm.nih.gov), Yunnan-2 and Yunnan-3 sequences were found to be 99% and 98% identical to the Otsu-type strain from Japan (AB 119446·1), respectively.
Neighbor-joining tree of Babesia microti inferred from the 1078 bp sequence of 18S rRNA gene using the Neighbor-joining algorithm method with the Kimura two-parameter model. The number on each branch denotes the percent occurrence in 1000 bootstrap replicates. Three genetically different B. microti variants, Yunnan-1, Yunnan-2 and Yunnan-3, were detected. Yunnan-1, Yunnan-2 and Yunnan-3 were associated with Rattus (11/49, 22·5%), Apodemus (10/13, 76·9%) and Crocidura (5/10, 50·0%) species, respectively.
DISCUSSION
Babesia spp. are important parasitic protozoans carried by several mammalian hosts and known to cause diseases in humans. High tick infestation rates coupled with the prevalence of the pathogen in cats and dogs was demonstrated in the Wrocław Agglomeration of southwest Poland [Reference Król21]. B. microti and B. venatorum were found in 9·0% of Ixodes ricinus. Evidence suggests that dogs and cats may contribute substantially to the circulation of the pathogen among ticks. Some small mammals, such as voles [Reference Rar22] and other rodents [Reference Hamšíková23], are also involved in the enzootic maintenance and transmission of B. microti.
In this study, we detected B. microti in 4·3% of the rodent species in Yunnan. It is postulated that there might be more rodent species harboring B. microti than have been previously reported [Reference Zhou12], suggesting that a variety of mammalian species could be involved in the enzootic maintenance and transmission of B. microti. According to Zhou et al., Macaca species, Rattus species, Niviventer species and Citellus species are also capable of harboring B. microti [Reference Zhou12]. Our results indicate that a far greater number of rodents are potentially important for maintaining and transmitting B. microti. Prevalence of infected rodents is much higher in Lanping (20/115, 17·4%) than in other areas indicating that the residents of Lanping might be at a higher risk for B. microti infection. Similarly, people in Lianghe (11/141, 7·8%) and Tengchong (18/286, 6·3%) could also be at a higher risk of infection with B. microti, especially because 10 human cases of Babesia infection have already been reported in Tengchong [Reference Zhou16]. The highest risk of B. microti infection was observed in rodents captured from forests or shrublands, which may be related to the geographic distribution of ticks in these natural environments.
Three genetically different B. microti variants were detected (Fig. 2). Majority of the identified Babesia variants were similar to the Kobe-type genetic variant found in Japan with the capacity for infecting humans [Reference Tsuji24]. This strain of B. microti is different from the strains reported from Tengchong in Yunnan so far [Reference Zhou16]. The Kobe-type Babesia strain has also been detected in Zhejiang and Fujian provinces [Reference Saito-Ito11]. A wide distribution of Babesia strains implies a higher risk of human infections in other regions of China as well.
In conclusion, a variety of rodent species were found to be involved in the enzootic maintenance and transmission of B. microti. Future investigations are warranted to determine the potential risk of infection in local residents. The most common mode of infection was through tick bites, supporting the need for further investigation into ticks as the important carriers of B. microti.
SUPPLEMENTARY MATERIAL
The supplementary material for this article can be found at https://doi.org/10.1017/S0950268817001686.
ACKNOWLEDGEMENTS
This work was supported by the Natural Science Foundation of Beijing (grant no. 5152023), the Natural Science Foundation of China (grant numbers 31272385 and 30860250), and the State Key Laboratory of Biological Safety of Pathogenic Microorganisms (grant no. SKLPBS1435). The sponsors of the study had no role in the study design, data collection, data analysis, interpretation or writing the report.
ETHICS APPROVAL AND CONSENT TO PARTICIPATE
All studies and procedures were reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of State Key Laboratory of Pathogen and Biosecurity (IACUC-2009-036).
AVAILABILITY OF DATA AND MATERIAL
All data generated and analyzed during this study are included in this published article and its supplementary information files.
DECLARATION OF INTERESTS
The authors declare that they have no competing interests.
AUTHORS’ CONTRIBUTIONS
Bai JY, Ren LZ and Liu W conceived and designed; acquisition, analysis and interpretation of data were done by Chen XR, Fan JW, Ye L, Li C, Tang F and Liu W; Ren LZ and Bai JY drafted the manuscript or revising; final approval of the version to be published were done by Chen XR, Ye L, Fan JW, Li C, Tang F, Liu W, Ren LZ and Bai JY. Accountable for all aspects of the work and for ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved by Chen XR, Ye L, Fan JW, Li C, Tang F, Liu W, Ren LZ and Bai JY. All authors read and approved the final version of the manuscript.