Introduction
Nematodes within the genus Ditylenchus Filipjev, Reference Filipjev1936 comprise a large complex group of nematodes within the family Anguinidae Nicoll, Reference Nicoll1935 with very difficult taxonomy and discussed systematic position (Subbotin and Ryss Reference Subbotin and Ryss2024). The genus Ditylenchus sensu lato encompassed about 100 valid species, including plant-parasitic, phoretic association with insects in soil and mycophagous non-parasitic nematodes (Brzeski Reference Brzeski1991; Fortuner and Maggenti Reference Fortuner and Maggenti1987; Munawar et al. Reference Munawar, Rahman, Castillo and Yevtushenko2023). Two main classifications systems for the genus Ditylenchus have been discussed during the past three decades proposed by Fortuner and Maggenti (Reference Fortuner and Maggenti1987) (synonymizing five related genera, including Boleodoroides, Diptenchus, Nothotylenchus, Orrina, and Safianema) and by Siddiqi (Reference Siddiqi2000) (maintaining separated all these genera).
Given the limited morphological variation that characterises Ditylenchus-like nematodes, molecular methods have been developed for DNA barcoding using various nuclear ribosomal and mitochondrial DNA markers (Gu et al. Reference Gu, Ma, Castillo and Munawar2023; Munawar et al. Reference Munawar, Rahman, Castillo and Yevtushenko2023; Oliveira et al. Reference Oliveira, Santin, Seni, Dietrich, Salazar, Subbotin, Mundo-Ocampo, Goldenberg and Barreto2013; Qiao et al. Reference Qiao, Yu, Badiss, Zaidi, Ponomareva, Hu and Ye2016; Subbotin et al. Reference Subbotin, Madani, Krall, Sturhan and Moens2005, Reference Subbotin, Sturhan, Chizhov, Vovlas and Baldwin2006; Vovlas et al. Reference Vovlas, Troccoli, Palomares-Rius, De Luca, Liébanas, Landa, Subbotin and Castillo2011, Reference Vovlas, Troccoli, Palomares-Rius, De Luca, Cantalapiedra-Navarrete, Liébanas, Landa, Subbotin and Castillo2016). The results of these studies have provided valid and accurate tools for separating cryptic species complex such as Ditylenchus dipsaci-Ditylenchus gigas complex (Vovlas et al. Reference Vovlas, Troccoli, Palomares-Rius, De Luca, Liébanas, Landa, Subbotin and Castillo2011). Furthermore, as proposed by Subbotin and Ryss (Reference Subbotin and Ryss2024), all these studies suggested that Ditylenchus is a paraphyletic taxon within Anguinoidea with several independent lineages. In fact, based on integrative taxonomical approaches using results from morphological data and phylogenetic analyses of ribosomal rRNA gene sequences within the superfamily Anguinoidea (Nicoll, Reference Nicoll1935) Siddiqi, Reference Siddiqi1980, Subbotin and Ryss (Reference Subbotin and Ryss2024) proposed the division of Ditylenchus sensu lato in three genera: Ditylenchus (including only plant-parasitic species), Ditylenchoides Subbotin & Ryss, Reference Subbotin and Ryss2024, and Paraditylenchus Subbotin & Ryss, Reference Subbotin and Ryss2024.
The genus Ditylenchoides contains about 20 species of nematodes characterized by median bulb muscular or non-muscular, basal bulb offset from intestine, secretory-excretory pore at middle part of basal bulb, lateral field mostly with 6 incisures (4 incisures in some species), crustaformeria in form of quadricolumella, post-vulval uterine sac 0.5–3.1 times longer than the vulval body diameter, and tail conical or subcylindrical, terminus mostly rounded (Esmaeili et al. Reference Esmaeili, Ye and Subbotin2024; Subbotin and Ryss Reference Subbotin and Ryss2024). Phylogenetic relationships within the genus Ditylenchoides in previous studies are congruent, suggesting the monophyly of this taxon based on ribosomal markers (28S expansion segments of 28S rRNA, ITS rRNA, and the partial 18S rRNA), and clearly separate this genus from other Ditylenchus sensu lato species (Esmaeili et al. Reference Esmaeili, Ye and Subbotin2024; Lian and Chen Reference Lian and Chen2025; Munawar et al. Reference Munawar, Rahman, Castillo and Yevtushenko2023; Subbotin and Ryss Reference Subbotin and Ryss2024).
During nematode surveys conducted in the spring of 2023 to investigate the biodiversity of plant-parasitic nematodes in Mediterranean olive groves under different management strategies (organic and conventional), as well as their nearest patch of natural vegetation in Greece, Italy, Morocco, Portugal and Spain, a rare nematode population was detected. This population, found in the rhizosphere of Indian fig opuntia (Opuntia ficus-indica (L.) Mill., 1768) at Meknès, in the Fez-Meknès region of Morocco, exhibited a delicate stylet (< 10 μm), six lines at the lateral fields and morphologically resembling Ditylenchoides, but surprisingly with a female subcylindrical tail with widely rounded tip. This finding prompted us to study this population using an integrative taxonomic approach constructed on morphological and molecular analyses, along with comprehensive scanning electron microscopy (SEM) studies. Up to our knowledge, no detection of these nematodes has been reported in Morocco; consequently, this finding of a new population of Ditylenchoides sp. at Morocco provides an excellent chance for ribosomal and mitochondrial molecular characterisation as well as phylogenetic studies. Both of them are crucial in taxonomic and systematic studies of Anguinoidea that will improve our understanding of the evolution of these nematodes.
Then, the key objectives of this study were i) to characterise morphologically and morphometrically the new unidentified nematode population of Ditylenchoides sp. and compare it with related species; ii) to characterise molecularly the new unidentified nematode population using the D2-D3 expansion segments of 28S rRNA, ITS rRNA, partial 18S rRNA, and cytochrome oxidase c subunit 1 (COI) gene sequences; and iii) to study the phylogenetic relationships of the new unidentified nematode population of Ditylenchoides sp. with available sequenced taxa of the superfamily Anguinoidea.
Material and methods
Nematode population and morphological characterisation
Sampling was conducted in Meknès, Fez-Meknès region, Morocco, in an olive grove and adjacent patch of natural vegetation. Specimens of the unidentified population were mainly isolated from the rhizosphere soil of Indian fig opuntia (Opuntia ficus-indica (L.) Mill.). Soil samples were collected within 5 to 30 cm soil depth, and nematodes were extracted from a 500 cm3 subsample of soil by centrifugal flotation (Coolen Reference Coolen, Lamberti and Taylor1979). Extracted specimens were heat killed, fixed in TAF, processed to glycerol by a slow evaporation method, and mounted on permanent slides (De Grisse Reference De Grisse1969; Seinhorst Reference Seinhorst1966). The light microscopy (LM) pictures and measurements of the nematode population, including the main diagnostic characteristics (i.e., de Man ratios, body length, stylet length, lip region, tail length, and shape), were performed using a Leica DM6 compound microscope with a Leica DFC7000 T digital camera. All abbreviations used are as defined in Siddiqi (Reference Siddiqi2000).
For scanning electron microscopy (SEM), fixed specimens were dehydrated in a gradient series of ethanol, critical-point dried, sputter-coated with gold according to the protocol by Abolafia et al. (Reference Abolafia, Liébanas and Peña-Santiago2002), and observed with a Jeol IT 800 SHL Scanning Electron Microscope (5 kV; Tokio, Japan).
Molecular characterisation and phylogenetic analyses
For molecular analyses, single specimens from the sample were temporarily mounted in a drop of 1M NaCl containing glass beads (to prevent nematode specimens from crushing/damaging) to ensure specimens conformed with the target population. This was followed by DNA extraction from single individuals as described by Archidona et al. (2024). The D2-D3 expansion segments were amplified using the D2A (5’-ACAAGTACCGTGAGGGAAAGTTG-3’) and D3B (5’-TCGGAAGGAACCAGCTACTA-3’) primers (De Ley et al. Reference De Ley, Félix, Frisse, Nadler, Sternberg and Thomas1999). The ITS region was amplified using forward primer 18S (5′-TTGATTACGTCCCTGCCC TTT-3′) and reverse primer Vrain2r (5′-TTT CACTCGCCGTTACTAAGGGAATC-3′) (Vrain et al. Reference Vrain, Wakarchuk, Levesque and Hamilton1992). The partial 18S rRNA was amplified using the primers 988 (5′-CTCAAAGATTAAGCCATGC-3′), 1912R (5′-TTTACGGTCAGAACTAGGG-3′), 1813F (5´- CTGCGTGAGAGGTGAAAT -3/), and 2646R (5/- GCTACCTTGTTACGACTTTT -3/) (Holterman et al. Reference Holterman, Van Der Wurff, Den Elsen, van Megen, Bongers, Holovachov, Bakker and Helder2006). Finally, the portion of the COI gene was amplified using the primers JB3 (5´- TTTTTTGGGCATCCTGAGGTTTAT -3`) and JB5 (5’- AGCACCTAAACTTAAAACATAATGAAAATG -3´) (Derycke et al. Reference Derycke, Remerie, Vierstraete, Backeljau, Vanfleteren, Vincx and Moens2005).
All PCR assays were done according to the conditions described by Archidona-Yuste et al. (Reference Archidona-Yuste, Clavero-Camacho, Ruiz-Cuenca, Cantalapiedra-Navarrete, Liébanas, Castillo and Palomares-Rius2024). Then, the amplified PCR products were purified using ExoSAP-IT (Affimetrix, USB products) and used for direct sequencing on a DNA multicapillary sequencer (Model 3130XL genetic analyser; Applied Biosystems, Foster City, CA, USA), using the BigDye Terminator Sequencing Kit V.3.1 (Applied Biosystems, Foster City, CA, USA), at the Stab Vida sequencing facilities (Caparica, Portugal). The newly obtained sequences were submitted to the National Center for Biotechnology Information (NCBI) database under the accession numbers indicated on the phylogenetic trees.
Phylogenetic analyses
D2-D3 expansion segments of 28S rRNA gene, ITS rRNA region, partial 18S rRNA gene, and COI mtDNA sequences of the unidentified Ditylenchoides sp. population were obtained in this study. These sequences, and other sequences from species of Anguinoidea from NCBI, were used for phylogenetic analyses. Outgroup taxa for each dataset were chosen following previously published studies (Esmaeili et al. Reference Esmaeili, Ye and Subbotin2024; Lian and Chen Reference Lian and Chen2025; Subbotin and Ryss Reference Subbotin and Ryss2024). Multiple sequence alignments of the different genes were made using the FFT-NS-2 algorithm of MAFFT V.7.450 (Katoh et al. Reference Katoh, Rozewicki and Yamada2019). The BioEdit program V. 7.2.5 (Hall Reference Hall1999) was used for sequence alignment visualization and manually edited and trimmed of the poorly aligned positions using a light filtering strategy (up to 20% of alignment positions), which has little impact on tree accuracy and may save computation time (Tan et al. Reference Tan, Muffato, Ledergerber, Herrero, Goldman, Gil and Dessimoz2015). Phylogenetic analyses of the sequence datasets were based on Bayesian inference (BI) using MrBayes 3.1.2 (Ronquist and Huelsenbeck Reference Ronquist and Huelsenbeck2003). The best-fit model of DNA evolution was achieved using JModelTest V.2.1.7 (Darriba et al. Reference Darriba, Taboada, Doallo and Posada2012) with the Akaike information criterion (AIC). The best-fit model, the base frequency, the proportion of invariable sites, and the gamma distribution shape parameters and substitution rates in the AIC were then used in MrBayes for phylogenetic analyses. The best-fit model for each dataset was the general time-reversible model with invariable sites and gamma distribution model (GTR + I + G) for the D2-D3 expansion segments of 28S rRNA gene and for the partial 18S rRNA gene. Bayesian analyses were run separately per dataset with four chains for 10 × 106 generations. A combined analysis of the three ribosomal genes was not undertaken because some sequences were not available for all species. The sampling for Markov chains was conducted at intervals of 100 generations. For each analysis, two runs were conducted. After discarding burn-in samples of 30% and evaluating convergence, the remaining samples were retained for more in-depth analyses. The topologies were used to generate a 50% majority-rule consensus tree. For each appropriate clade, posterior probabilities (PP) were given. FigTree software version v.1.4.4 (Rambaut Reference Rambaut2018) was used for visualizing trees from all analyses.
Results
Only one soil sample, collected from the rhizosphere soil of Indian fig opuntia in Meknès, Fez-Meknès region of Morocco, contained a Ditylenchoides species at a high population density (412 nematodes/500 cm3 of soil). This contrasts with its very low frequency found in the adjacent olive grove (1/264 = 0,004). Detailed morphological, morphometrical, and molecular information about this species is provided below, corroborating its identity as a new species of the genus Ditylenchoides described herein.
Systematics
Phylum: Nematoda Rudolphi, Reference Rudolphi1808
Class: Chromadorea Inglis Reference Inglis1983
Order: Rhabditida Chitwood Reference Chitwood1933
Suborder: Tylenchina Chitwood Reference Chitwood, Chitwood and Chitwood1950
Superfamily: Anguinoidea (Nicoll, Reference Nicoll1935) Siddiqi, Reference Siddiqi1980
Family: Anguinidae Nicoll, Reference Nicoll1935
Genus: Ditylenchoides Subbotin & Ryss, Reference Subbotin and Ryss2024
Ditylenchoides morocciensis sp. nov
urn:lsid:zoobank.org:act:5A85F66B-EF82-41CC-AAA7-C0043B48E54E
Description
Morphometrics of Ditylenchoides morocciensis sp. nov. from Meknès, Fez-Meknès region, Morocco

* Abbreviations are defined in Siddiqi (Reference Siddiqi2000). All measurements are in μm and in the form mean ± standard deviation (range) where appropriate, except for ratio.
Ditylenchoides morocciensis sp. nov. (drawings). (a) entire female body; (b) female pharyngeal region; (c) detail of lip region showing stylet; (d) detail of en face view of lip region showing oral and amphidial apertures; (e) detail of mid-body region showing lateral fields; (f) female tail.

Female. Body almost cylindrical, straight or slightly curved in posterior half following heat fixation (Figures 1 and 2). Cuticle finely annulated, 1.01.5 μm wide. Lateral fields 4.0–4.5 μm wide, with six smooth incisures occupying 22–30% of body diam. (Figures 1–3). SEM pictures showed lateral fields starting with 2 incisures at 12–15 annuli posterior to lip region (Figure 3a), and some irregular areolation in outer bands (Figure 3e). Lip region anteriorly flattened, continuous with body contour rounded, finely annulated with 4–5 annuli detected with SEM (Figures 1–3), 5.7 (5.0–6.0) μm wide. Labial framework a little sclerotized (Figure 2g,h). En face view SEM observations (Figure 3) showed a quadrangular oral plate, a pore-like oral aperture surrounded by six outers labial sensilla, and amphidial apertures as minute pore-like at the edge of labial plate (Figure 3c,d). Stylet delicate with rounded basal knobs 2.1 (2.0–2.5) μm wide, sloping backwards, anterior conical part 2.6 (2.5–3.0) μm long. Dorsal pharyngeal gland opening 1.9 (1.5–2.5) μm posterior to stylet base. Pharynx tylenchoid; procorpus cylindroid 26.1 (24.0–31.0) μm long; median bulb oval, 7.1 (6.5–10.0) μm wide × 9.4 (8.0–12.0) μm long, moderately muscular, with valves 1.5–2.0 μm long, and located at 46.7 (42.1–57.5)% of pharyngeal length; isthmus slender 24.4 (20.0–28.0) μm long, basal bulb pyriform 7.7 (6.5–9.0) μm wide × 16.1 (13.0–18.0) μm long, with round margins, not overlapping intestine (Figures 1 and 2). Nerve ring surrounding the middle part of the isthmus. Excretory pore slightly sclerotized, located at middle of basal bulb. Hemizonid not always clear; when seen, one or two body annuli anterior to excretory pore. Reproductive system monodelphic prodelphic, formed by an outstretched ovary with oocytes arranged in a single file; crustaformeria in form of quadricolumella of four rows; spermatheca oval, slightly developed, without sperm; vagina perpendicular to body axis; vulva a transverse slit in ventral view, without lateral flaps (Figure 2), 9.0–10.0 μm wide. Post-vulval uterine sac 1.6 (1.3–1.9) times body width. Vulva-anus distance 3.0 (2.4–3.4) times as long as tail. Tail subcylindrical, tail tip annulated and bluntly rounded.
Light micrographs of Ditylenchoides morocciensis sp. nov. female. (a) entire female; (b–f) pharyngeal region showing basal and median bulb with valve, excretory pore and stylet (arrowed); (g, h) detail of lip region showing stylet; (i) detail of mid-body region showing lateral fields; (j–l) female posterior region showing vulva, post-vulval uterine sac and anus; (m) tail showing anus (arrowed). Abbreviations: a = anus; bb = basal bulb; ep = excretory pore; lf = lateral fields; mb = median bulb; PUS = post-vulval uterine sac; st = stylet; va = valve; V = vulva. (Scale bars: a–f, i–m = 10 μm; g, h = 5 μm).

SEM micrographs of Ditylenchoides morocciensis sp. nov. female. (a): anterior region showing the beginning of lateral fields (lf); (b): lip region; (c, d): lip region en face view showing the oral aperture (oa) and amphidial aperture (am) arrowed; (e): mid-body view showing lateral fields (lf) arrowed; (f): posterior region showing lateral fields (lf), vulva (V), and anus (a) arrowed; (g, h): tail in lateral and ventral view showing anus (a). Abbreviations: a = anus; am = amphidial aperture; lf = lateral fields; V = vulva. (Scale bars: a, e, g, h = 1 μm; b, c = 0.5 μm; d = 0.1 μm; f = 5 μm).

Male. Not found.
Diagnosis and relationships
Ditylenchoides morocciensis sp. nov. is a parthenogenetic species characterised by a short body 460 (373–528 μm); stylet delicate, relatively short, 8.7 (8.0–9.0) μm long with rounded basal knobs; six lines in the lateral fields; median bulb of pharynx oval, muscular and valvate; secretory-excretory pore located at the level of basal pharyngeal bulb region; vulva located at 79.9 (76.9–81.3) % of body length; relatively long post-vulval uterine sac 29.1 (20.0–39.0) μm; and a subcylindrical tail 24.4 (22.0–28.0) μm long, with a bluntly rounded tip.
Morphological and morphometrically Ditylenchoides morocciensis sp. nov. is close to other species of this genus with 6 incisures in lateral fields including D. pedrami Azimi & Abdolkhani, Reference Azimi and Abdolkhani2023, D. africanus (Wendt et al., Reference Wendt, Swart, Vrain and Webster1995) Subbotin & Ryss, Reference Subbotin and Ryss2024, D. clarus (Thorne & Malek, Reference Thorne and Malek1968) Subbotin & Ryss, Reference Subbotin and Ryss2024, D. destructor (Thorne, Reference Thorne1945) Subbotin & Ryss, Reference Subbotin and Ryss2024, and D. anchilisposomus (Tarjan, Reference Tarjan1958) Subbotin & Ryss, Reference Subbotin and Ryss2024. From D. pedrami can be separated by a shorter body 460 (373–528) vs 629 (555–750) μm, a slightly shorter stylet 8.7 (8.0–9.0) vs 10.0 (9.0–11.0) μm long; lip region annulation (finely annulated with 4–5 annuli vs smooth), lower a ratio 25.3 (21.6–28.1) vs 31.6 (29.3–34.2); lower c′ ratio 2.1 (1.8–2.4) vs 2.8 (2.4–3.2); a shorter female tail 24.4 (22.0–28.0) vs 36.5 (32.0–41.0) μm long; female tail shape subcylindrical vs conoid with rounded or pointed tip; and males absent vs present (Azimi and Abdolkhani Reference Azimi and Abdolkhani2023). From D. africanus differs by a shorter body 460 (373–528) vs 1014 (699–1140) μm, morphology of basal bulb (offset from the intestine vs overlapping intestine), tail shape and length (subcylindrical, 24.4 (22.0–28.0) vs elongate-conoid, 71.5 (55.5–82.5) μm long and males absent vs present (Wendt et al. Reference Wendt, Swart, Vrain and Webster1995). From D. clarus can be separated by body length (460 (373–528) vs 700) μm, secretory-excretory pore position at the level of basal pharyngeal bulb region vs at isthmus level, and tail shape subcylindrical vs conoid. From D. destructor differs by a shorter body 460 (373–528) vs (810–1400) μm, a shorter stylet 8.7 (8.0–9.0) vs (10.0–14.0) μm long; lip region annulation (finely annulated with 4-5 annuli vs smooth), morphology of basal bulb (offset from the intestine vs overlapping intestine), lower a ratio 25.3 (21.6–28.1) vs (30–35); lower c′ ratio 2.1 (1.8–2.4) vs (3.0–5.0); female tail shape subcylindrical vs conoid with rounded tip; and males absent vs present (Hooper Reference Hooper1973). From D. anchilisposomus, differs by lower V ratio (79.9 (76.9–81.3) vs 85.3–88.7)), pharyngeal bulb offset from the intestine vs overlapping intestine, and tail shape subcylindrical with a bluntly rounded tip vs conoid with pointed tip.
Etymology
The species epithet is the Latin term morocciensis = the species name refers to Morocco, the country where the new species was found.
Type host and locality
The new species was recovered from the rhizosphere of Indian fig opuntia (Opuntia ficus-indica (L.) Mill.) at Meknès, Fez-Meknès region, Morocco (coordinates 33°47’44"N 5°40’00"W, 494 m a.s.l.).
Type material
Holotype female and 18 female paratypes deposited at Institute for Sustainable Agriculture (IAS) of Spanish National Research Council (CSIC), Córdoba, Spain (Slide numbers ZN4_2-02-ZN4_2-09); and two females at the USDA Nematode Collection (T-8216p).
Molecular characterisation
Ditylenchoides morocciensis sp. nov. was molecularly characterised by the sequences of three ribosomal genes (D2-D3 expansion segments of 28S rRNA, ITS rRNA and partial 18S rRNA), and the partial mitochondrial gene COI. The amplification of these regions generated single fragments of around 900, 1100, 1800, and 400 bp, respectively, based on gel electrophoresis. Eight D2-D3 expansion segments of 28S rRNA sequences from 624 to 643 bp (PV579161-PV579168), without intraspecific sequence variation; two ITS rRNA sequences from 783 to 830 bp (PV588665-PV588666), with scarce intraspecific sequence variation (99.9%, 1 bp, 0 indel); five 18S rRNA sequences from 1671 to 1699 bp (PV579169- PV579173), with scarce intraspecific sequence variation (99.9%, 2 bp, 0 indel); and five COI sequences of 365 to 397 bp (PV577399-PV577403), with scarce intraspecific sequence variation (99.7%, 1 bp, 1 indel) were generated for this new species. D2-D3 expansion segments of 28S rRNA of D. morocciensis sp. nov. (PV579161-PV579168) was 87.3% similar to Ditylenchoides sp. YZYX02 (OQ626861) from China, differing by 83 bp and 0 indel (unpublished); 87.1% similar to Ditylenchoides sp. 20181130 (MN446892) from Republic of the Union of Myanmar, differing by 83 bp and 0 indel (unpublished); 83.3% similar to D. persicus (KX463285) from Iran, differing by 110 bp and 23 indels (Esmaeili et al. Reference Esmaeili, Heydari, Castillo and Palomares-Rius2017a); 83.1% similar to D. stenurus (KX400577) from Iran, differing by 111 bp and 17 indels (Esmaeili et al. Reference Esmaeili, Heydari, Ziaie and Ye2017b); 82.0% similar to D. destructor (FJ707365) from Latvia, differing by 118 bp and 17 indels (Douda et al. Reference Douda, Marek, Zouhar, Marek and Rysanek2013); 78.4% similar to D. gracicauda (PP379177) from Canada, differing by 139 bp and 13 indels (Munawar et al. Reference Munawar, Rahman, Castillo and Yevtushenko2023); and 78.2% similar to D. pedrami (ON391933) from Iran, differing by 139 bp and 27 indels (Azimi and Abdolkhani Reference Azimi and Abdolkhani2023). ITS of D. morocciensis sp. nov. (PV588665-PV588666) showed a low coverage (less than 44%) with sequences of Anguinoidea spp. too variable to be aligned properly with other sequences of Ditylenchoides or Anguinoidea species deposited in NCBI; therefore, they were excluded from the BLAST search and the phylogenetic analyses. The partial 18S of D. morocciensis sp. nov. (PV579169-PV579173) was 96.9% similar to Ditylenchus sp. ND02 (OQ613352) from China, differing by 53 bp and 4 indels (unpublished); 96.1% similar to Ditylenchus sp. 85C1 (MK292126) from USA, differing by 66 bp and 8 indels (Carta and Li Reference Carta and Li2019); 96.0% similar to Ditylenchus sp. USA (PP099650) from USA, differing by 67 bp and 7 indels (Pereira et al. Reference Pereira, De Santiago and Bik2024); 95.2% similar to D. gilanicus (MG835411) from Iran, differing by 76 bp and 7 indels (Yaghoubi et al. Reference Yaghoubi, Pourjam, Ye, Castillo and Pedram2018); and 92.6% similar to D. pedrami (ON391943) from Iran, differing by 72 bp and 11 indels (Azimi and Abdolkhani Reference Azimi and Abdolkhani2023). Finally, COI of D. morocciensis sp. nov. (PV577399-PV577403) were the second sequence of this marker for the genus Ditylenchoides (after D. rafiqi-OP163311 of pomegranate from India, unpublished); our sequences showed a 74.1% similarity with D. rafiqi-OP163311 (differing by 89 bp and 24 indels, coverage = 84%).
Phylogenetic relationships of Ditylenchoides morocciensis sp. nov. with other Anguinoidea spp.
Phylogenetic relationships among Ditylenchoides morocciensis sp. nov. with other Anguinoidea spp., as inferred from analyses of D2-D3 expansion segments of 28S rRNA and the partial 18S rRNA gene sequences using BI, are shown in Figures 4 and 5, respectively. Difficulties were experienced with the alignment of the ITS and COI sequences because of scant homology with other sequences of Anguinoidea spp. deposited in GenBank and accordingly; no further phylogenetic analysis was performed using ITS and COI sequences (PV588665-PV588666, PV577399-PV577403, respectively). The phylogenetic trees generated with the ribosomal DNA markers (D2-D3 expansion segments of 28S rRNA and the partial 18S rRNA) included 76 and 47 sequences with 699 and 1704 characters in length, respectively (Figures 4 and 5). The D2-D3 expansion segments of 28S rRNA tree of Anguinoidea spp. showed two well-supported separated clades (PP = 1.00), the basal one including all the species of the genus Ditylenchoides and the upper one comprising several subclades with different genera from Anguinoidea, including Ditylenchus, Paraditylenchus, Zeatylenchus, Orrina, Subanguina, etc. (Figure 4). D2-D3 expansion segments of 28S rRNA sequences of D. morocciensis sp. nov. (PV579161-PV579168) clustered together with D. gracicauda (PP379177) from Japan (Gu et al. Reference Gu, Ma, Castillo and Munawar2024), but in a low supported subclade (PP = 0.90) and in a well-supported clade (PP = 0.99) with other species, such as D. acutus (MF996704), D. rafiqi (OP023115), D. gilanicus (MG742325), D. sarvarae (KX281168), and D. pedrami (ON391933).
Phylogenetic relationships of Ditylenchoides morocciensis sp. nov. with species of Anguinidae. Bayesian 50% majority rule consensus tree as inferred from D2 and D3 expansion segments of 28S rRNA sequence alignment under the GTR + I+ G model (−lnL = 15930.1257; AIC = 32188.251480; freqA = 0.1807; freqC = 0.1838; freqG = 0.3240; freqT = 0.3115; R(a) = 1.0867; R(b) = 4.6125; R(c) = 1.9538; R(d) = 0.5364; R(e) = 5.8662; R(f) = 1.0000; Pinva = 0.2240; and Shape = 0.8550). Posterior probabilities more than 0.70 are given for appropriate clades. Newly obtained sequences in this study are shown in bold, and coloured box indicates clade association of the new species. Scale bar = expected changes per site.

Phylogenetic relationships of Ditylenchoides morocciensis sp. nov. with species of Anguinidae. Bayesian 50% majority rule consensus tree as inferred from 18S rRNA sequence alignment under the GTR + I+ G model (−lnL = 11926.1874; AIC = 24056.374800; freqA = 0.2586; freqC = 0.2009; freqG = 0.2643; freqT = 0.2763; R(a) = 1.5515; R(b) = 3.1679; R(c) = 1.8613; R(d) = 0.5997; R(e) = 6.2057; R(f) = 1.0000; Pinva = 0.1450; and Shape = 0.5840). Posterior probabilities more than 0.70 are given for appropriate clades. Newly obtained sequences in this study are shown in bold, and coloured box indicates clade association of the new species. Scale bar = expected changes per site.

The 50% majority rule consensus 18S rRNA gene BI tree showed also two well-supported separated clades (PP = 1.00), the basal one including all the species of the genus Ditylenchoides and the upper one comprising several subclades with different genera from Anguinoidea (Figure 5). 18S rRNA sequences of D. morocciensis sp. nov. (PV579169-PV579173) clustered in a well-supported subclade (PP = 1.00) together with an unidentified Ditylenchoides sp. ND02 (OQ613352) from China (unpublished), and together with D. gilanicus (MG835411) from Iran (Yaghoubi et al. Reference Yaghoubi, Pourjam, Ye, Castillo and Pedram2018) (Figure 5).
Discussion
Ditylenchus-like nematodes show a great conserved general morphology and a high simplicity, which makes species identification a very difficult task. Only a few of morphological traits (number of lines in the lateral fields, stylet length, V, c and c’ ratios, shape of female tail, etc.) have been proven sufficiently reliable for species identification (Sturhan and Brzeski Reference Sturhan, Brzeski and Nickle1991; Vovlas et al. Reference Vovlas, Troccoli, Palomares-Rius, De Luca, Liébanas, Landa, Subbotin and Castillo2011). Integrative taxonomical approaches (morphometrical, LM, SEM, and molecular markers) have shown crucial for an accurate identification and phylogenetic relationships of these nematodes, allowing to separate cryptic species complex and define new generic taxa (Gu et al. Reference Gu, Ma, Castillo and Munawar2023; Munawar et al. Reference Munawar, Rahman, Castillo and Yevtushenko2023; Oliveira et al. Reference Oliveira, Santin, Seni, Dietrich, Salazar, Subbotin, Mundo-Ocampo, Goldenberg and Barreto2013; Qiao et al. Reference Qiao, Yu, Badiss, Zaidi, Ponomareva, Hu and Ye2016; Subbotin and Ryss Reference Subbotin and Ryss2024; Vovlas et al. Reference Vovlas, Troccoli, Palomares-Rius, De Luca, Liébanas, Landa, Subbotin and Castillo2011, Reference Vovlas, Troccoli, Palomares-Rius, De Luca, Cantalapiedra-Navarrete, Liébanas, Landa, Subbotin and Castillo2016). The main objective of this study was to identify and describe, morphologically and molecularly, a new population of Ditylenchoides detected in Indian fig opuntia at Meknès, Morocco, as well as clarify the phylogenetic relationships of this genus within the superfamily Anguinoidea using ribosomal markers. Altogether, results from a morphological and molecular analyses confirmed that the unknown Ditylenchoides population from Morocco is a new valid species of the genus herein described as D. morocciensis sp. nov. The present study enhanced the knowledge of the biodiversity of Ditylenchoides genus, and up to our knowledge, this is the first report in Morocco. Our morphological measurements and SEM results provide clear evidence that this population belongs to the genus Ditylenchoides, and the lip region structure (quadrangular oral plate en face view) is consistent with previous studies on other Ditylenchoides species including D. africanus (Wendt et al. Reference Wendt, Swart, Vrain and Webster1995) or D. arachis (Zhang et al. Reference Zhang, Liu, Janssen, Zhang, Xiao, Li, Couvreur and Bert2014). The tail shape of D. morocciensis sp. nov. (subcylindrical with tail tip annulated and bluntly rounded) reinforced the morphological differences separating the genera Ditylenchus (tail terminus sharp to pointed or mucronate) and Ditylenchoides as already established by Subbotin and Ryss (Reference Subbotin and Ryss2024).
Phylogenetic analyses of ribosomal markers (D2-D3 expansion segments of 28S rRNA and partial 18S rRNA) of this study confirmed that the genus Ditylenchoides comprised a monophyletic lineage clearly separated from other genera within Anguinoidea such as Ditylenchus, Paraditylenchus, Zeatylenchus, Orrina, Subanguina, etc., and these findings agree with previous studies (Esmaeili et al. Reference Esmaeili, Ye and Subbotin2024; Lian and Chen Reference Lian and Chen2025; Munawar et al. Reference Munawar, Rahman, Castillo and Yevtushenko2023; Subbotin and Ryss Reference Subbotin and Ryss2024). Also, phylogenetic analyses are consistent to separate D. morocciensis sp. nov. from all other species of this genus with available molecular data. These data are of valuable interest, since this genus include several species pathogenic for crops such as D. destructor (potato tuber nematode), D. africanus (peanut pod nematode), or D. arachis (peanut pod rot) (Dickson and De Waele Reference Dickson, De Waele, Luc, Sikora and Bridge2005; Sturhan and Brzeski Reference Sturhan, Brzeski and Nickle1991), and confirm the recent taxonomic position of the genus Ditylenchoides as a separate lineage from all other genera in Anguinoidea (Subbotin and Ryss Reference Subbotin and Ryss2024). Since the COI gene has only been explored for two species of Ditylenchoides (D. rafiqi-OP163311 and D. morocciensis sp. nov.-PV577399-PV577403), additional efforts on this molecular marker may be useful in the near future for clarifying phylogenetic relationships of Ditylenchoides with other genera within Anguinoidea, as it is one of the most important standard barcoding genes that has been used for many free-living and plant-parasitic nematodes (Álvarez-Ortega and Subbotin Reference Álvarez-Ortega and Subbotin2024; Palomares-Rius et al. Reference Palomares-Rius, Cantalapiedra-Navarrete, Archidona-Yuste, Subbotin and Castillo2017; Powers et al. Reference Powers, Harris, Higgins, Mullin and Powers2021; Vovlas et al. Reference Vovlas, Troccoli, Palomares-Rius, De Luca, Liébanas, Landa, Subbotin and Castillo2011).
In summary, the present study confirms the monophyletic condition of the genus Ditylenchoides and the use of applying integrative taxonomy in Anguinoidea to decipher the actual diversity of these nematodes, which may be much higher than expected, given that molecular diversity (rRNA and mtDNA markers) remarkably exceeds the low morphological diversity of Anguinoidea species. Further studies regarding the biology and feeding behaviour as well as the potential pathogenic capability with the present host association of D. morocciensis sp. nov. are interesting features to discover in the future.
Acknowledgements
The authors thank J. Martín Barbarroja and G. León Ropero for their excellent technical contributions. SEM pictures were obtained with the assistance of technical staff and the equipment of ‘Centro de Instrumentación Científico-Técnica (CICT)’, University of Jaén and CIC University of Granada, Spain. This research was funded by the grant Soil O-Live, from the European Union’s Horizon Europe research and innovation programme under grant agreement No. 101091255 (Soil Deal for Europe - HORIZON-MISS-2021-SOIL-02-03). R. Salazar-García’s contract is financed by Soil O-Live grant. A. Archidona-Yuste is funded by the Ramón y Cajal program (RYC2021-031108-I), funded by MCIN/AEI/https://doi.org/10.13039/501100011033 and UE ‘Next Generation EU/PRTR’. This work was also partially supported by the Consejería de Universidad, Investigación e Innovación-Junta de Andalucía, Qualifica Project (QUAL21_023 IAS).
Competing interests
Authors stated no conflict of interest.
Ethical standard
The result of this work has not been published previously and is not under consideration elsewhere.
Ethical approval
The conducted research is not either related to human or animals use.