Hostname: page-component-74d7c59bfc-6nqbt Total loading time: 0 Render date: 2026-02-11T01:59:09.492Z Has data issue: false hasContentIssue false

The first study on opportunistic intestinal microsporidiosis in IBD patients receiving immunosuppressive medications in Iran

Published online by Cambridge University Press:  15 May 2017

Z. HASANI
Affiliation:
Foodborne and Waterborne Diseases Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran
H. ASADZADEH AGHDAEI
Affiliation:
Basic and Molecular Epidemiology of Gastrointestinal Disorders Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran
H. BALAII
Affiliation:
Basic and Molecular Epidemiology of Gastrointestinal Disorders Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran
M. AZIMIRAD
Affiliation:
Foodborne and Waterborne Diseases Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran
E. S. MIRSAMADI
Affiliation:
Department of Microbiology, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran
H. MIRJALALI*
Affiliation:
Foodborne and Waterborne Diseases Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran
M.R. ZALI
Affiliation:
Gastroenterology and Liver Diseases Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran
*
*Author for correspondence: Dr H. Mirjalali, Foodborne and Waterborne Diseases Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran, Iran. (Email: hamed_mirjalali@hotmail.com)
Rights & Permissions [Opens in a new window]

Summary

Microsporida are known as opportunistic unicellular organisms and have recently been reclassified as fungi that have been frequently reported from patients with congenital and acquired immunity failure disorders, worldwide. However, use of immunosuppressive medications in inflammatory bowel disease (IBD) patients significantly decreases overall immunity, and increases their susceptibility to opportunistic infections. Totally, 71 stool samples were collected from IBD patients consisted of 69 ulcerative colitis (UC) patients and two Crohn's disease (CD) patients. All patients had taken immunosuppressive and/or immunomodulator drugs for at least 3 weeks. DNA was extracted from all stool samples and Nested PCR was performed using genus-specific primers based on small subunit ribosomal RNA (SSU rRNA) gene. Fisher's Exact Test was applied to evaluate statistical association between microsporidia infection and sex, age and types of IBD. Mean of age ± s.d., women and men percentage of the attended patients were 36·17 ± 11·93, 60·6%, and 39·4%, respectively. A 440-bp fragment of SSU rRNA gene attributed to Enterocytozoon bieneusi was amplified from 12·7% of IBD patients. No Encephalitozoon DNA was detected in the samples. No microsporidia-positive sample was found in CD patients. Fisher's Exact Test showed that there was no statistically significant correlation between intestinal microsporidiosis and age, sex, and IBD types with P values: 0·389, 1·00, and 1·00, respectively. This study has shown IBD patients undergoing immunosuppressive/immunomodulators medications, which may be susceptible to intestinal microsporida infection. E. bieneusi is the commonest intestinal microsporidan reported from IBD patients.

Information

Type
Short Report
Copyright
Copyright © Cambridge University Press 2017 

Microsporida are known as opportunistic unicellular organisms and have recently been reclassified as fungi [Reference Capella-Gutierrez, Marcet-Houben and Gabaldon1]. This microorganism has frequently been reported from both immunocompromised and immunocompetent individuals, as well as a broad range of animals all over the world [Reference Field and Milner2, Reference Askari3]. Microsporidia infection in immunocompromised patients, particularly HIV/AIDS patients, is one of the most important concerns of healthcare systems. Reports of microsporida infection have risen worldwide due to the increase in congenital/acquired immunity system disorders [Reference Abdelmalek4]. Enterocytozoon bieneusi is one of the most prevalent human-infecting microsporidan species reported from HIV/AIDS patients [Reference Mirjalali5], patients undergoing chemotherapy [Reference Lono, Kumar and Chye6], and individuals with immunity disorders.

Inflammatory bowel disease (IBD) is a complex gastrointestinal disorder and the etiological agent is not clearly known. Crohn's disease (CD) and ulcerative colitis (UC) are the two most important chronic IBD, frequently reported worldwide [Reference Ko and Auyeung7, Reference Corridoni, Arseneau and Cominelli8]. Several genetic, environmental, and immunological factors have been suggested as triggers of immunological disorders and subsequent IBD. Nowadays, immunosuppressive/immunomodulatory agents such as corticosteroids and anti-inflammatory drugs are used to manage conditions of IBD patients [Reference Ko and Auyeung7]. However, the increasing use of immunosuppressive drugs in IBD patients, significantly decreases overall immunity and increases susceptibility to opportunistic infections. However, subsequent events of immunosuppressive therapy in IBD patients convinced the ECCF (European Crohn's and Colitis Foundation) to state that IBD patients on corticosteroids, biological agents, and immunomodulators are normally more susceptible to opportunistic pathogens [Reference Rahier9].

Several studies have presented different opportunistic microbial pathogens from IBD patients [Reference Dave10]. Since intestinal microsporidiosis is considered as an opportunistic infection, frequently reported from immunocompromised patients, IBD patients undergoing immunosuppressive drugs could be more susceptible to this infection.

However, the current study is the first survey to investigate intestinal microsporidiosis in IBD patients undergoing immunosuppressive therapy.

Totally, 71 stool samples were collected from IBDs patients consisted of 69 UC patients and two CD patients who had been referred to IBD clinic of Research Institute for Gastrointestinal and Liver Diseases in Shahid Beheshti University of Medical Sciences, Tehran during May 2015 to April 2016. A trained interviewer filled up a questionary consisted of age, sex, and type of IBD. All patients had taken immunosuppressive and/or immunomodulator drugs for at least 3 weeks. Stool samples were immediately transferred to the Parasitology Laboratory of Foodborne and Waterborne Diseases Research Center, Research Institute for Gastroenterology and Liver Diseases in Shahid Beheshti University of Medical Sciences and further investigations were carried out on the samples.

DNA extraction was performed for all stool samples using QIAamp DNA Stool mini Kit according to the manufacturer's instruction. Nested PCR was performed using genus-specific primers based on small subunit ribosomal RNA (SSU rRNA) gene according to the literature mentioned elsewhere [Reference Mirjalali5]. Briefly, the first pair primers, PMicF (5′ – GGTTGATTCTGCCTGACG – 3′) and PMicR (5′ – CTTGCGAGC(G/A)TACTATCC – 3′), amplified 779 bp of SSU rRNA gene of Encephalitozoon spp. and Enterocytozoon bieneusi. The second PCR employed primers EnbF (5′ – GGTAATTTGGTCTCTGTGTG – 3′) and EnbR (5′ – CTACACTCCCTATCCGTTC – 3′) to amplify 440 bp as well as EncepF (5′ – AGTACGATGATTTGGTTG – 3′) and EncepR (5′ – ACAACACTATATAGTCCCGTC – 3′) to amplify 629 bp fragments for E. bieneusi and Encephalitozoon spp., respectively.

First, PCR reaction was performed in final volume 25 µl containing 12·5 µl of 2× Ampliqon PCR Master Mix (Denmark) 10 ρM of each primers. Amplifications were carried out in Eppendorf thermocycler (Hamburg, Germany). The conditions for the first PCR reaction were: 95 °C for 5 min followed by 35 cycles of 94 °C for 40 s, 55 °C for 45 s, 72 °C for 45 s, and final extension of 72 °C for 4 min. The second PCR conditions were: 95 °C for 5 min followed by 25 cycles of 94 °C for 35 s, 57 °C for 35 s, 72 °C for 40 s, and 72 °C for 3 min as a final extension. The 10 µl of PCR products were electrophoresed on 1·5% of agarose gel and were visualized after ethidium bromide staining. A positive (sequenced isolates with accession no. KJ414444) and negative (Sterile Distillated Water) control were run together with all samples.

Fisher's Exact Test was applied to evaluate statistical association between microsporidia infection and sex, age, and type of IBD using IBM SPSS Statistics for Windows, v22 (Chicago, IL, USA). A P-value <0·05 was considered statistically significant.

Totally, 71 patients including 69 (97·18%) and 2 (2·82%) had UC and CD, respectively. IBD and type of IBD were proven in all patients using by colonoscopy and pathology evaluations. Mean of age ± s.d., women and men percentage of the attended patients were 36·17 ± 11·93, 60·6% and 39·4%, respectively. All demographic data are summarized in Table 1. All enrolled patients had received one or several following drugs: Methyl-prednisolone or hydrocortisone, infliximab and mesalamine at least for 3 weeks. All patients had watery diarrhea or semi-form stool at the time of sampling.

Table 1. Demographic and summarized data of microsporidia infected patients among IBD subjects

* P-value was not applicable.

PCR reactions were carried out on all DNA extracted samples and nine (12·7%) samples were identified as positive. All nine positive samples showed 440 bp fragment of SSU rRNA gene attributed to E. bieneusi, while no DNA amplification was found by specific primers for Encephalitozoon spp. Furthermore, all E. bieneusi positive-samples were seen in UC patients (13·4%), while no positive sample was found in CD patients. Statistical analysis was performed and Fisher's Exact Test showed that there was no statistically significant correlation between intestinal microsporidiosis and age, sex, and IBD types with P-values: 0·389, 1·00, and 1·00, respectively.

Microsporida infection is one of the most important concerns and complications of physicians treating immunocompromised patients. Recently, gastrointestinal microsporidiosis was described as an emerging infectious disease reported from immunocompromised patients [Reference Mirjalali5].

Nowadays, increase in the number of immune system disorders has led to opportunistic microorganisms being considered as one of the main secondary problems in immunocompromised patients. Several opportunistic microorganisms have been reported from IBD patients on corticosteroids, immunomodulators, and biological agents. Although the co-existence of some viruses, bacteria, and fungi were represented, there are scarce data available on opportunistic parasites in IBD patients [Reference Dave10].

Studies have reported the opportunistic infection of intestinal microsporidia from almost all countries [Reference Field and Milner2]. However, gastrointestinal microsporidiosis not only decreases the life-quality of IBD patients, but also increases the intricacy of the therapy process. The current study is the first to report gastrointestinal microsporidiosis in IBD patients undergoing immunosuppressive therapy. Recently, Andreu-Ballester et al. suggested an etiological role for microsporidia in CD patients before immunosuppression and stated that due to deficiencies of δγT lymphocytes and IL-7, CD patients are likely to be more susceptible to colonization of intestinal microsporida. In contrast with our study, all enrolled patients in mentioned research had not been treated for CD and had not undergone immunosuppression therapy [Reference Andreu-Ballester11].

The prevalence rate of the microsporidia infection in the current study was 12·7%. In Iran, there are studies that described intestinal microsporidia from HIV/AIDS patients [Reference Mirjalali5, Reference Agholi, Hatam and Motazedian12], cancer patients under chemotherapy and transplant recipients [Reference Mirjalali13]. A previous study from Iran by Mirjalali et al. showed high prevalence (30·86%) of E. bieneusi among HIV/AIDS patients, while some other studies reported lower rates of the infection [Reference Mirjalali5]. Agholi et al. found E. bieneusi from 9·55% of HIV/AIDS patients and 6·81% of transplant recipient children in the south of Iran [Reference Agholi, Hatam and Motazedian12, Reference Agholi, Hatam and Motazedian14]. In another study, Tabatabaie et al. reported prevalence rates of 5·3% and 4% for E. bieneusi and Encephalitozoon sp., respectively, in healthy subjects and 0·7% and 5·7% for E. bieneusi and Encephalitozoon sp., respectively, in various samples of immunocompromised patients [Reference Tabatabaie15]. In our study, only E. bieneusi was found in 12·7% of IBD patients who underwent immunosuppressive/immunomodulator medications. The prevalence rate of our study is similar and in agreement with other studies showing microsporidiosis in immunocompromised patients in Iran.

In the current study, only E. bieneusi was detected in all microsporidia-positive patients and no DNA of Encephalitozoon was amplified. Almost all previous studies in Iran showed that E. bieneusi had a higher prevalence rate [Reference Askari3, Reference Mirjalali5, Reference Agholi, Hatam and Motazedian12, Reference Agholi, Hatam and Motazedian14]. On the other hand, the interesting point is that metronidazole consumption with or without prescription is common in IBD patients to prevent diarrhea. Although, He et al. showed that metronidazole could be effective against Encephalitozoon spp. [Reference He16], but E. bieneusi is perceived as resistant to benzimidazoles such as metronidazole [Reference Canning and Hollister17]. Therefore, the low prevalence of Encephalitozoon spp., compared with E. bieneusi in IBD patients, as our results showed, could be predictable.

In this study, no positive sample was detected in CD patients. This finding is more likely related to the number of CD patients. In Iran, the prevalence rate of UC is more than the CD cases [Reference Taghavi18] and unfortunately, at the time of sampling the number of CD cases was very low. However, intestinal microsporidia, particularly E. bieneusi, should be considered as one of the most important opportunistic microorganisms, capable of increasing the complexity of managing IBD patients.

IBD patients undergoing immunosuppressive, corticosteroid, and immunomodulator agents could be susceptible to intestinal microsporida infection. In addition, E. bieneusi is the commonest microsporidian species reported from this group of IBD patients.

ACKNOWLEDGEMENTS

The authors would like to appreciate all colleagues of Foodborne and Waterborne Diseases Research Center for their laboratory cooperation.

DECLARATION OF INTEREST

None.

References

REFERENCES

1. Capella-Gutierrez, S, Marcet-Houben, M, Gabaldon, T. Phylogenomics supports microsporidia as the earliest diverging clade of sequenced fungi. BMC Biology 2012; 10: 47.CrossRefGoogle ScholarPubMed
2. Field, AS, Milner, DA. Jr. Intestinal microsporidiosis. Clinics in Laboratory Medicine 2015; 35(2): 445459.CrossRefGoogle ScholarPubMed
3. Askari, Z, et al. Molecular detection and identification of zoonotic microsporidia spore in fecal samples of some animals with close-contact to human. Iranian Journal of Parasitology 2015; 10(3): 381388.Google Scholar
4. Abdelmalek, R, et al. [Microsporidia and cryptosporidia coinfection in an HIV-infected newborn]. Archives de Pediatrie: organe officiel de la Societe francaise de pediatrie 2011; 18(5): 562564.Google Scholar
5. Mirjalali, H, et al. Emerging intestinal microsporidia infection in HIV(+)/AIDS Patients in Iran: Microscopic and Molecular Detection. Iranian Journal of Parasitology 2014; 9(2): 149154.Google ScholarPubMed
6. Lono, AR, Kumar, S, Chye, TT. Incidence of microsporidia in cancer patients. Journal of Gastrointestinal Cancer 2008; 39(1–4): 124129.Google Scholar
7. Ko, JK, Auyeung, KK. Inflammatory bowel disease: etiology, pathogenesis and current therapy. Current Pharmaceutical Design 2014; 20(7): 10821096.Google Scholar
8. Corridoni, D, Arseneau, KO, Cominelli, F. Inflammatory bowel disease. Immunology Letters 2014; 161(2): 231235.Google Scholar
9. Rahier, JF, et al. Second European evidence-based consensus on the prevention, diagnosis and management of opportunistic infections in inflammatory bowel disease. Journal of Crohn's & Colitis 2014; 8(6): 443468.CrossRefGoogle ScholarPubMed
10. Dave, M, et al. Opportunistic infections due to inflammatory bowel disease therapy. Inflammatory Bowel Diseases 2014; 20(1): 196212.CrossRefGoogle ScholarPubMed
11. Andreu-Ballester, JC, et al. Microsporidia and its relation to Crohn's disease. A retrospective study. PLoS ONE 2013; 8(4): e62107.CrossRefGoogle ScholarPubMed
12. Agholi, M, Hatam, GR, Motazedian, MH. HIV/AIDS-associated opportunistic protozoal diarrhea. AIDS Research and Human Retroviruses 2013; 29(1): 3541.Google Scholar
13. Mirjalali, H, et al. Genotyping and molecular analysis of Enterocytozoon bieneusi isolated from immunocompromised patients in Iran. Infection, Genetics and Evolution: Journal of Molecular Epidemiology and Evolutionary Genetics in Infectious Diseases 2015; 36: 244249.Google Scholar
14. Agholi, M, Hatam, GR, Motazedian, MH. Microsporidia and coccidia as causes of persistence diarrhea among liver transplant children: incidence rate and species/genotypes. The Pediatric Infectious Disease Journal 2013; 32(2): 185187.Google Scholar
15. Tabatabaie, F, et al. Molecular detection of microsporidiosis in various samples of Iranian immunocompromised patients. Journal of Parasitic Diseases: Official Organ of the Indian Society for Parasitology 2015; 39(4): 634638.Google Scholar
16. He, Q, et al. Effects of nifedipine, metronidazole, and nitric oxide donors on spore germination and cell culture infection of the microsporidia Encephalitozoon hellem and Encephalitozoon intestinalis . Antimicrobial Agents and Chemotherapy 1996; 40(1): 179185.Google Scholar
17. Canning, EU, Hollister, WS. Enterocytozoon bieneusi (Microspora): prevalence and pathogenicity in AIDS patients. Transactions of the Royal Society of Tropical Medicine and Hygiene 1990; 84(2): 181186.Google Scholar
18. Taghavi, SA, et al. Epidemiology of inflammatory bowel diseases (IBD) in Iran: a review of 740 patients in Fars Province, Southern Iran. Annals of Colorectal Research 2013; 1(1): 1722.Google Scholar
Figure 0

Table 1. Demographic and summarized data of microsporidia infected patients among IBD subjects