Hostname: page-component-77f85d65b8-2tv5m Total loading time: 0 Render date: 2026-04-14T17:22:50.698Z Has data issue: false hasContentIssue false

Homologous basic helix–loop–helix transcription factors induce distinct deformations of torsionally-stressed DNA: a potential transcription regulation mechanism

Published online by Cambridge University Press:  10 June 2022

Johanna Hörberg
Affiliation:
Department of Chemistry and Molecular Biology, University of Gothenburg, 40530 Gothenburg, Sweden
Kevin Moreau
Affiliation:
Department of Chemistry and Molecular Biology, University of Gothenburg, 40530 Gothenburg, Sweden
Anna Reymer*
Affiliation:
Department of Chemistry and Molecular Biology, University of Gothenburg, 40530 Gothenburg, Sweden
*
*Author for correspondence: Anna Reymer, E-mail: anna.reymer@gu.se
Rights & Permissions [Opens in a new window]

Abstract

Changing torsional restraints on DNA is essential for the regulation of transcription. Torsional stress, introduced by RNA polymerase, can propagate along chromatin facilitating topological transitions and modulating the specific binding of transcription factors (TFs) to DNA. Despite the importance, the mechanistic details on how torsional stress impacts the TFs-DNA complexation remain scarce. Herein, we address the impact of torsional stress on DNA complexation with homologous human basic helix–loop–helix (BHLH) hetero- and homodimers: MycMax, MadMax and MaxMax. The three TF dimers exhibit specificity towards the same DNA consensus sequence, the E-box response element, while regulating different transcriptional pathways. Using microseconds-long atomistic molecular dynamics simulations together with the torsional restraint that controls DNA total helical twist, we gradually over- and underwind naked and complexed DNA to a maximum of ± 5°/bp step. We observe that the binding of the BHLH dimers results in a similar increase in DNA torsional rigidity. However, under torsional stress the BHLH dimers induce distinct DNA deformations, characterised by changes in DNA grooves geometry and a significant asymmetric DNA bending. Supported by bioinformatics analyses, our data suggest that torsional stress may contribute to the execution of differential transcriptional programs of the homologous TFs by modulating their collaborative interactions.

Information

Type
Research Article
Creative Commons
Creative Common License - CCCreative Common License - BY
This is an Open Access article, distributed under the terms of the Creative Commons Attribution licence (http://creativecommons.org/licenses/by/4.0), which permits unrestricted re-use, distribution and reproduction, provided the original article is properly cited.
Copyright
© The Author(s) 2022. Published by Cambridge University Press

Introduction

Changing torsional restraints on DNA comprise one of the major regulatory forces of eukaryotic transcriptional control (Lavelle, Reference Lavelle2008; Kouzine et al., Reference Kouzine, Gupta, Baranello, Wojtowicz, Ben-Aissa, Liu, Przytycka and Levens2013; Ma et al., Reference Ma, Bai and Wang2013; Naughton et al., Reference Naughton, Avlonitis, Corless and Gilbert2013; Corless and Gilbert, Reference Corless and Gilbert2016; Fogg et al., Reference Fogg, Judge, Stricker, Chan and Zechiedrich2021). In transcription, torsional strain is primarily introduced by RNA polymerase which forces DNA to rotate around its axis as the molecule threads through the transcription machinery (Osborne et al., Reference Osborne, Chakalova, Brown, Carter, Horton, Debrand, Goyenechea, Mitchell, Lopes, Reik and Fraser2004; Boeger et al., Reference Boeger, Bushnell, Davis, Griesenbeck, Lorch, Strattan, Westover and Kornberg2005). The imposed torsional strain underwinds and overwinds DNA upstream and downstream of a transcribed gene, respectively, and can propagate along the chromatin fibre. The speeds and ranges of torsional strain propagation depend on the underlying nucleotide sequence (Naughton et al., Reference Naughton, Avlonitis, Corless and Gilbert2013). When propagating along the chromatin fibre torsional stain brings changes to the genome organisation: locally introducing DNA bending and twisting, which affects the stability of nucleosome core particles (Teves and Henikoff, Reference Teves and Henikoff2014), and higher-order chromatin structures (Corless and Gilbert, Reference Corless and Gilbert2016). Through these changes, torsional strain can modulate transcription of near-located genes. Generally, genes that experience torsional strain are more efficiently transcribed (Weintraub et al., Reference Weintraub, Cheng and Conrad1986; Dunaway and Ostrander, Reference Dunaway and Ostrander1993). Furthermore, the torsional strain might be necessary for the initiation of transcription (Tabuchi and Hirose, Reference Tabuchi and Hirose1988; Mizutani et al., Reference Mizutani, Ohta, Watanabe, Handa and Hirose1991a, Reference Mizutani, Ura and Hirose1991b; Schultz et al., Reference Schultz, Brill, Ju, Sternglanz and Reeder1992; Dunaway and Ostrander, Reference Dunaway and Ostrander1993), as DNA underwinding appears essential for the melting of the TATA-box sequence near transcription start sites (Liebl and Zacharias, Reference Liebl and Zacharias2020). To complete the picture of how torsional strain contributes to eukaryotic transcriptional control, we must also understand how torsional strain impacts DNA specific binding by transcription factor proteins (Noy et al., Reference Noy, Sutthibutpong and Harris2016; Hörberg and Reymer, Reference Hörberg and Reymer2020; Pyne et al., Reference ALB, Noy, KHS, Velasco-Berrelleza, Piperakis, Mitchenall, Cugliandolo, Beton, CEM, Hoogenboom, Bates, Maxwell and Harris2021).

Locally DNA responds to moderate torsional strain, below any buckling transitions (i.e. plectonemes formation or melting) (Lankaš, Reference Lankaš2020; Ott et al., Reference Ott, Martini, Lipfert and Gerland2020; Dohnalová and Lankaš, Reference Dohnalová and Lankaš2022), in a heterogeneous and sequence-specific manner. Certain dinucleotide steps, mainly pyrimidine–purine (YpR) but also purine–purine (RpR), depending on their flanking environment exhibit twist bimodality, where two substates can be separated by as much as 20° in twist (Kannan et al., Reference Kannan, Kohlhoff and Zacharias2006; Liebl and Zacharias, Reference Liebl and Zacharias2017, Reference Liebl and Zacharias2020; Hörberg and Reymer, Reference Hörberg and Reymer2018; Reymer et al., Reference Reymer, Zakrzewska and Lavery2018). These flexible dinucleotides, termed ‘twist-capacitors’, contribute to a multi-well free energy surface of DNA twisting, can effectively absorb torsional strain allowing the rest of DNA to preserve a B-like conformation. The twist-capacitor dinucleotides appear to regulate protein-DNA complexation, as twisting transitions are coupled to changes in shift and slide (Dans et al., Reference Dans, Pérez, Faustino, Lavery and Orozco2012, Reference Dans, Balaceanu, Pasi, Patelli, Petkevičiūtė, Walther, Hospital, Bayarri, Lavery, Maddocks and Orozco2019; Pasi et al., Reference Pasi, Maddocks, Beveridge, Bishop, Case, Cheatham, Dans, Jayaram, Lankas, Laughton, Mitchell, Osman, Orozco, Pérez, Petkeviciute, Spackova, Sponer, Zakrzewska and Lavery2014; Balaceanu et al., Reference Balaceanu, Buitrago, Walther, Hospital, Dans and Orozco2019) – helical parameters important for the protein-DNA readout mechanism (Hörberg et al., Reference Hörberg, Moreau, Tamás and Reymer2021). Previously, we addressed the impact of torsional strain on DNA complexation with a human basic-leucine-zipper (BZIP) transcription factor (TF) MafB (Hörberg and Reymer, Reference Hörberg and Reymer2020). When specifically bound to its DNA target, the protein locks the twist-capacitor dinucleotides in one conformational substate, favourable for the complexation. Consequently, the energy cost for DNA twisting almost doubles – suggesting that BZIP factors may hinder the propagation of torsional strain along DNA, potentially regulating the cooperative binding of collaborative TFs, or contributing to alterations in genome topology. These results provide first insights; a complete understanding of the mechanistic aspects of how torsional strain affects TF-DNA complexation remains limited. TF-DNA complexes involving other families of TFs may respond differently to torsional stress. Also, there might be differences among homologous TFs.

We herein address the impact of torsional strain on DNA complexation with three homologous basic helix–loop–helix (BHLH) TFs dimers, MycMax, MadMax and MaxMax. The BHLH factors is one of the most abundant families of eucaryotic TFs that modulate cell proliferation, differentiation and apoptosis (Atchley and Fitch, Reference Atchley and Fitch1997; De Masi et al., Reference De Masi, Grove, Vedenko, Alibés, Gisselbrecht, Serrano, Bulyk and AJM2011; Dennis et al., Reference Dennis, Han and Schuurmans2019; de Martin et al., Reference de Martin, Sodaei and Santpere2021). The MycMax, MadMax and MaxMax dimers exhibit specificity towards identical DNA consensus sequences – yet regulate different transcriptional pathways (Grandori et al., Reference Grandori, Cowley, James and Eisenman2000; Diolaiti et al., Reference Diolaiti, McFerrin, Carroll and Eisenman2015; Giardino Torchia and Ashwell, Reference Giardino Torchia and Ashwell2018). We study MaxMax, MycMax and MadMax dimers bound to the palindromic sequence ‘5′-GGCGAGTAGCACGTGCTACTCGC-3’, containing the E-box response element (in italics) under relaxed and torsionally restrained conditions using microsecond-long umbrella sampling molecular dynamics (MD) simulations. With the torsional restraint that controls the total twist of DNA, that is, the end-to-end twist, without restricting other degrees of freedom, we gradually over- and underwind DNA to a maximum of ± 5°/base pair (bp) step. We observe that, relative to unbound DNA, the BHLH factors make DNA more torsionally rigid, resulting in similar torsional moduli for complexed DNA. However, under torsional stress, the BHLH factors induce distinct DNA deformations. We complement our mechanistic studies with bioinformatics analysis. Using CHIP-seq data on several cell lines, we explore what other TFs bind DNA in close proximity to Myc, Max and Mad proteins. Our results suggest: distinct responses to DNA twisting by homologous TFs may be a complementary mechanism to variations in transactivation domains (TAD), contributing to the recruitment of different collaborative TFs and, subsequently, differential regulatory responses.

Methods

Simulated systems

Four systems: MycMax- (PDB ID: 1NKP) (Nair and Burley, Reference Nair and Burley2003), MadMax- (PDB ID: 1NLW) (Nair and Burley, Reference Nair and Burley2003), MaxMax-bound DNA (PDB ID: 1AN2) (Ferré-D’Amaré et al., Reference Ferré-D’Amaré, Prendergast, Ziff and Burley1993) and free DNA in B-form were studied. All systems contain a DNA 23-mer: GGCGAGTAGCACGTGCTACTCGC, with the E-box region in italics. USCF Chimera (Pettersen et al., Reference Pettersen, Goddard, Huang, Couch, Greenblatt, Meng and Ferrin2004) was used to modify the DNA sequence of the MaxMax-DNA complex to match that of the MycMax-DNA and MadMax-DNA complexes; and to determine the protonation state of His residues. JUMNA (Lavery et al., Reference Lavery, Zakrzewska and Sklenar1995) program was then used to extend the flanking sites and to relax bad protein-DNA contacts.

Molecular dynamics simulation protocol

All molecular dynamics (MD) simulations are performed with the MD engine GROMACS v2019.4 (Abraham et al., Reference Abraham, Murtola, Schulz, Páll, Smith, Hess and Lindahl2015) using same protocol as described previously (Hörberg and Reymer, Reference Hörberg and Reymer2020). In the restrained MD simulations of cascade umbrella sampling, we use the in-house developed torsional restraint (Reymer et al., Reference Reymer, Zakrzewska and Lavery2018) that controls the end-to-end twist (total twist) of a DNA fragment. The code of the DNA twisting restraint and a user guide is available at https://github.com/annareym/PLUMED_DNA-Twist. The restraint sets the desired value of twist ref using a simple quadratic function, K tw (twist–twistref)2, implemented via PLUMED v2.5.3 (Bonomi et al., Reference Bonomi, Branduardi, Bussi, Camilloni, Provasi, Raiteri, Donadio, Marinelli, Pietrucci, Broglia and Parrinello2009). We use the force constant (K tw) of 0.06 kcal mol−1 degree−2, the smallest value that provides the desired twist without inducing any structural artefacts. In all simulations we use AMBER 14SB (Maier et al., Reference Maier, Martinez, Kasavajhala, Wickstrom, Hauser and Simmerling2015) and Parmbsc1 (Ivani et al., Reference Ivani, Dans, Noy, Pérez, Faustino, Hospital, Walther, Andrio, Goñi, Balaceanu, Portella, Battistini, Gelpí, González, Vendruscolo, Laughton, Harris, Case and Orozco2016) force fields to treat the proteins and DNA, respectively. The protein-DNA complexes and free DNA oligomer are separately solvated in cubic periodic boxes by SPC/E (Mark and Nilsson, Reference Mark and Nilsson2001) water molecules with a buffer distance of 12 Å to the walls. The systems are first neutralised by K+ counterions, then additional K+ and Cl− ions are added to reach a physiological salt-concentration of 150 mM. Applying periodic boundary conditions, each system is subjected to energy minimization with 5,000 steps of steepest descent, followed by 500 ps equilibration-runs with week position restraints on heavy solute atoms (1,000 kJ mol−1) in the NVT and NPT ensembles to adjust temperature (Berendsen et al., Reference Berendsen, Postma, van Gunsteren, DiNola and Haak1984) and pressure (Parrinello and Rahman, Reference Parrinello and Rahman1981) to 300 K and 1 atm. Releasing the restraints, 0.6 μs simulations are then carried out at constant pressure and temperature (1 atm and 300 K).

Following the unrestrained MD simulations, the cascade umbrella sampling (Torrie and Valleau, Reference Torrie and Valleau1977) is performed with 0.5 μs sampling time per umbrella window to allow sufficient convergence of DNA conformational substates and ion populations. We apply the twist restraint to the central E-box region and the four adjacent 5′- and 3′-flanking nucleotides; 13 bp steps in total (GGCGAGTAGCACGTGCTACTCGC). The initial value of twistref is the averaged end-to-end twist of the restrained fragment for each system, obtained through postprocessing of the unrestrained MD simulations with the twist restraint. For unbound-DNA, MycMax- and MaxMax-bound DNA the value of twistref is initially set to 450°, and for MadMax-bound DNA – to 445°. Starting from a relaxed state, the end-to-end twist of the restrained fragment is gradually changed by ± 0.5°/bp step (±6.5° in total per umbrella window), until a maximum overwound and underwound state of 5°/bp step is reached. The final structure from every window is used as the starting point for the following umbrella window. The weighted histogram analysis method (WHAM) (Kumar et al., Reference Kumar, Rosenberg, Bouzida, Swendsen and Kollman1992), implemented in PLUMED is used to derive the potential of mean force (PMF) with respect to DNA twisting. The total umbrella sampling MD simulation time for each system is 10.5 μs.

Elastic force constant analysis

Quadratic regression analysis in MatLab is used to obtain the twisting force constants, K (kcal mol−1 deg−2) from the PMF profiles. The analysis is performed for the regions corresponding to a ∆tw of ± 2°. The derived force constants are used to calculate DNA torsional modulus at room temperature in nm according to the homogeneous rod model, given by Eq. (1); where T is the torque that results from a change in twist ∆ $ \theta $ over a standard bp length L (0.34 nm):

(1) $$ T=K\Delta \theta =\frac{C\Delta \theta }{k_B TL}. $$

Trajectory analysis

Curves+ and Canal (Lavery et al., Reference Lavery, Moakher, Maddocks, Petkeviciute and Zakrzewska2009) programs are used to derive DNA helical parameters, backbone torsional angles, and groove geometry parameters for each trajectory snapshot extracted at 1 ps intervals. DNA deformation energies for the restrained region (GGCGAGTAGCACGTGCTACTCGC) are calculated using a model by Liebl and Zacharias (Reference Liebl and Zacharias2021). The model combines a quadratic harmonic deformation approximation model with an Ising model to allow for inclusion of coupling between all possible conformational substates of the DNA duplex. The model has been parameterized for all 136 tetranucleotides. The model utilises the six inter-base pair (shift, slide, rise, twist, tilt and roll) and the six intra-base pair (shear, stagger, stretch, buckle, propeller twist and opening) parameters to calculate the deformation energy for DNA. The deformation energies have been calculated for every snapshot for the relaxed, ± 4.5°/bp, and ± 2.5°/bp twisting trajectories, which provides the trajectory average DNA deformation energy and the standard deviations. The CPPTRAJ (Roe and Cheatham, Reference Roe and Cheatham2013) tool from AMBERTOOLS16 software package is used to derive specific and nonspecific protein-DNA contacts along the different torsional regimes as described previously (Hörberg and Reymer, Reference Hörberg and Reymer2020).

Bioinformatic analysis

Analysis of the nearest binding partners of Myc and Max was performed using TFregulomeR (Lin et al., Reference Lin, Thieffry, Jha and Benoukraf2020) package on ChIP-seq datasets from multiple cell lines (A549, NB4 and K562) downloaded from TFregulomeR data compendium. The output gives, among other information, the top-10 co-binders (ChIP-seq signal around ±100 bp of the peaks summits, corresponding to the binding of the studied TFs). The TFregulomeR package allows to differentiate the Myc and Max binding distribution corresponding district genomic regions such as promoter, introns, exons, intergenic regions, and so forth.

Additional information

MatLab and R software (R Core Team, 2013) were used for post-processing and plotting of all data. USCF Chimera (Pettersen et al., Reference Pettersen, Goddard, Huang, Couch, Greenblatt, Meng and Ferrin2004) was used for creating molecular graphics.

Results

Torsional moduli of free and complexed DNA

To address how changing torsional restraints on DNA impact the molecular complexation with homologous transcription factors and consequently their transcription regulatory programs, we select homo- and heterodimers of the Myc/Max/Mad network. The Myc/Max/Mad proteins belong to the BHLH family of eukaryotic transcription factors (TFs) that exhibit specificity towards the same DNA response elements but play distinct roles in transcriptional control. Upon association with its DNA target sites, the MycMax dimer acts as a transcriptional activator, which induces histone acetylation. The MadMax dimer antagonises MycMax and acts as a transcriptional repressor, which recruits histone deacetylases. The MaxMax dimer also antagonises MycMax, however, since Max lacks a transactivation/transrepression domain, it is considered transcriptionally inert (Grandori et al., Reference Grandori, Cowley, James and Eisenman2000).

We first subject the MaxMax-, MycMax- and MadMax-DNA complexes and free DNA, containing the E-box response element sequence (‘GGCGAGTAGCACGTGCTACTCGC’) (Fig. 1) to unrestrained MD simulations. We continue with cascade umbrella sampling using the torsional restraint that controls end-to-end twist of a restrained DNA region. The restraint is applied to the E-Box response element and the four adjacent 5′- and 3′ flanking nucleotides, 13 bp steps in total. Starting from the relaxed duplex, we gradually over- and underwind free and protein-bound DNA until reaching a maximum of ±5°/bp step (corresponding to ±0.15 in supercoiling density, σ). In accordance with previous studies, at all simulated torsional regimes the restrained DNA region in the four systems preserves a B-like conformation. We observe no significant DNA bp flipping or melting, as supported by DNA stretch and opening distributions (Supplementary Figs 3A–D and 4A–D) as well as by hydrogen bond distances between the heavy atoms of Watson–Crick bps, which remain below 4 Å (Supplementary Fig. 5). In addition, we observe no significant bending for free DNA (Supplementary Fig. 2) with a smooth decrease in the bending angle when going from underwound to overwound state. For protein-bound DNA, bending becomes more significant at higher degrees of underwinding and overwinding (Supplementary Fig. 2), reflecting changes in DNA groove geometry and roll angles due to the protein presence.

Figure 1. (a) Sequence alignment of the basic helix–loop–helix domain of Myc, Max and Mad. (b) Crystal structure of MycMax-DNA (PDB ID: 1NKP), MadMax-DNA (PDB ID: 1NLW) and MaxMax-DNA (PDB ID: 1AN2) complexes bound to the E-Box element in red. For each complex, specific protein-DNA contacts seen in the crystal structures are highlighted. The Watson strand (5′– > 3′) is denoted with ‘w’ and the Crick (3′– > 5′) strand is denoted with ‘c’.

The selected torsional restraints range should be seen as an approximation of extreme local changes that may arise, for example, near transcription starting sites upon transcription initiation (Naughton et al., Reference Naughton, Avlonitis, Corless and Gilbert2013; Irobalieva et al., Reference Irobalieva, Fogg, Catanese, Sutthibutpong, Chen, Barker, Ludtke, Harris, Schmid, Chiu and Zechiedrich2015; Muskhelishvili and Travers, Reference Muskhelishvili and Travers2016), which allows us to gain mechanistic insights into these highly dynamic aspects of eukaryotic transcriptional control. The selected range may be an exaggeration, as the value of σ = ± 0.15, is much higher than the upper limit of negative supercoiling density that has been measured (~−0.07) in the nucleus. However, the value of σ = −0.07 constitutes an average for bulk DNA, while DNA supercoiling density is not uniformly distributed in the genome, it can vary significantly along genomic DNA and also vary rapidly with time (Naughton et al., Reference Naughton, Avlonitis, Corless and Gilbert2013). Particularly, for transcription initiation, local negative DNA supercoiling density could in principle reach a value of −1 (Muskhelishvili and Travers, Reference Muskhelishvili and Travers2016), as DNA undertwisting facilitates the formation of the transcription bubble. The bubble is concentrated in short sequence regions ~10–20 bp, where no writhing is expected to occur and changes in DNA supercoiling density will be accommodated through changes in bp twist. Furthermore, the net supercoiling density generated by RNA polymerase is zero, thus the local change in positive supercoiling density should be equal to that of negative supercoiling density. As DNA complexes with TF proteins are formed in the vicinity of transcription starting sites, they will therefore experience the full range of extreme changes in DNA supercoiling density, which justifies the selected range of the torsional restraints. However, the ultimate range of in vivo changes in torsional restraints on DNA remains to be determined.

From the torsionally restrained MD simulations we derive the potential of mean force (PMF) profiles showing the free energy cost for DNA twisting transitions (Fig. 2a and Supplementary Fig. 1). To compare the PMF profiles, we plot the changes in the end-to-end twist as the average twist per bp step with respect to the relaxed average twist that varies from 34.0° for MadMax-bound DNA to 34.7° for MycMax-bound DNA (Supplementary Table 1). To compare the torsional rigidity of DNA in the four systems, we derive the torsional force constants and torsional moduli, using quadratic regression (Supplementary Fig. 6 and Supplementary Table 1). We observe that the binding of the BHLH dimers make DNA more torsionally rigid, resulting in the torsional moduli of 153, 163 and 168 nm for MycMax-, MadMax- and MaxMax-bound DNA, respectively, versus 111 nm for free DNA. The observation is consistent with our previous study of a BZIP factor MafB (Hörberg and Reymer, Reference Hörberg and Reymer2020), where we showed that the TF binding almost doubles the torsional rigidity of DNA (207 nm for complexed versus 107 nm for free DNA). It should be noted that MafB recognises longer response elements (13–14 bps) compared to the BHLH factors (6 bps), which may explain the differences in the induced torsional rigidity of TF-bound DNA. Though, other aspects of TF-DNA complexation, for example, whether proteins form specific contacts with twist-capacitor dinucleotides. Nevertheless, the increased torsional rigidity of TF-bound DNA, suggests that TFs may hinder the propagation of torsional stress. However, we believe, the effect is local and by increasing the length of the restrained region the torsional modulus for TF-bound DNA will eventually converge towards that of free DNA. Yet in the topological conditions of real genomes, the local increase in DNA torsional rigidity may provide a substantial regulatory force.

Figure 2. (a) PMF profiles showing the energy cost for twisting transitions for free and BHLH-bound DNA. (b) MycMax-, MadMax- and MaxMax induced DNA deformations are shown for (1) underwound regime, (2) torsionally relaxed regime and (3) overwound regime; with the restrained DNA region in red, MycMax in blue, MadMax in magenta, and MaxMax in pink. (c) DNA deformation energy of the restrained region (GTAGCACGTGCTAC, E-box response element in italics) calculated with a multivariate Ising model (Liebl and Zacharias, Reference Liebl and Zacharias2021).

Despite the similar increase in DNA torsional rigidity, induced by the protein binding, we observe that the three BHLH dimers deform DNA in a different fashion. Starting from – 1.0°/bp during the underwinding regime, we observe that DNA molecules experience a local bending deformation induced by an increased roll angle at several bp steps and changed geometry of DNA grooves (Fig. 2b, Supplementary Fig. 1, and Supplementary Videos 1–4). The torsionally induced deformations differ also between free and protein-bound DNA (Supplementary Fig. 1). For free DNA the imposed torsional stress is evenly distributed over the entire restrained region (Fig. 3), with no significant bending even at higher torque regimes (Supplementary Fig. 2). While for protein-bound DNA (see details below), the imposed torsional stress is mostly accumulated in the flanking regions outside the E-box response element (Fig. 3), where the observed deformations are predominantly localised.

Figure 3. Changes of bp twist angles for the restrained DNA-region in free and MycMax-, MadMax- and MaxMax-bound DNA as a function of the requested average change of twist per base pair step, indicated by a colourbar to the right.

For a subset of twisting trajectories, we also calculate the deformation energies (Fig. 2c) for the restrained DNA regions (GGCGAGTAGCACGTGCTACTCGC) using a model by Liebl and Zacharias (Reference Liebl and Zacharias2021), which allows to estimate the change of free energy coupled to changes in DNA conformational flexibility due to the imposed torsional stress. The deformation energies have been averaged over the entire umbrella window (500 ns) for the corresponding degrees of under- and overwinding. Although the standard deviations are rather high (~ 10 kcal mol−1), illustrating the large conformational landscape of DNA, the trend shows that in all four systems the deformation energies increase as the torsional restraints are applied, both for under- and overtwisting. The increase in energy is explained by the fact that the torsional stress shifts the distribution of DNA conformational substates, allowing the less populated substates at relaxed conditions to become more populated; these transitions cost more energy. The trends in Fig. 2c also show that the increase in deformation energies is system-specific, suggesting that torsional stress may modulate the differential transcriptional response of homologous BHLH TFs by differently impacting the local conformational flexibility of DNA.

Torsional stress-induced changes in DNA structure

To understand the BHLH dimer-specific torque-induced DNA deformations, we first analyse the contributions of individual bp steps to the absorption of the imposed torsional stress (Fig. 3 and Supplementary Fig. 7). We exclude from the discussion the outer bp steps (GpT and ApC) of the restrained region (GTAGCACGTGCTAC, the E-box response element in italics), as these steps absorb significant amount of torsional stress at the extreme torque regimes, which may be attributed to their location (on the edge of the restrained region) rather than any other effects. Contrary to free DNA, where the imposed torsional stress is absorbed by the flexible pyrimidine–purine steps, TpA and CpA, of the palindrome (GTAGCACGTGCTAC), for protein-bound DNA the CpA and TpG steps within the E-box sequence become torsionally-rigid. As a result, the torque accumulates mostly in the flanking regions. For MycMax- and MaxMax-bound DNA, the flanking TpA steps dominate the absorption of both negative and positive torque (Fig. 3). However, as the TpA steps exhibit a preference for a high twist state under the relaxed conditions (Supplementary Fig. 7), they are less efficient in absorbing positive torsional stress, contributing to an increased energy cost for DNA overtwisting. For MadMax-bound DNA the first flanking TpA step remains rigid, while the second flanking TpA step efficiently absorbs only positive torsional stress as it prefers a low twist state under the relaxed conditions (Fig. 3 and Supplementary Fig. 7). Thus, the imposed negative torsional stress is distributed among the less torsionally flexible bp steps in the second half-site of the restrained DNA region, which increases the energy cost for DNA undertwisting. Interestingly, for MadMax-bound DNA the ApG step (GTAGCACGTGCTAC) appears undergoing non-monotonic changes upon high level of undertwisting (−4.0°/bp step), that is, its twist increases. This will be further discussed in the next section, as this behaviour is due to the protein-DNA contacts formed by the loop of the Mad factor, which makes the TpA step torsionally rigid. However, upon high undertwisting, the increase in twist of the ApG step allows the TpA step to absorb some negative torsional stress, while still maintaining the interactions with the Mad-loop.

For the torsionally active bp steps, behaviour of other translational and rotational bp steps parameters (Supplementary Figs 8–14) under torsional stress follow the trends reported in our previous studies (Hörberg and Reymer, Reference Hörberg and Reymer2018; Reymer et al., Reference Reymer, Zakrzewska and Lavery2018): torsional stress brings changes in roll, shift, and slide – which are coupled to twist via BI/BII backbone conformational transitions. Roll shows negative correlation to twist, and slide – positive. Behaviour of the shift parameter appears more complexed. In the relaxed state, we observe shift bimodality/multimodality for the torsionally flexible bp steps, which changes as DNA undergoes under- and overtwisting.

We further characterise the differences in the BHLH dimer-specific torque-induced DNA deformations, by analysing DNA axis bending per bp step, characterised as the angle between the local axes of two adjacent bps (Fig. 4) and groove parameters (Fig. 5). For MycMax- and MaxMax-bound DNA we observe an asymmetric bending towards the major groove, that is, towards the basic region of the BHLH factors, during the underwinding regime. The axis bending for MycMax- and MaxMax-bound DNA, from the Myc- and Max_1-side, respectively, gradually increases with undertwisting up to 5° per bp step (Fig. 4 and Supplementary Videos 2 and 3). Max_1 of the MaxMax homodimer refers to the monomer, which forms a greater number of specific contacts with DNA (see Protein-DNA contacts for further details). Contrary, for MadMax-bound DNA, similarly to free DNA, we observe no significant DNA bending during underwinding. Overwinding also contributes to an increase in axis bending for all BHLH-bound DNA. However, the changes are smaller, about 2° per bp step, and more uniformly distributed over the restrained region, resulting in a symmetric smooth bending towards the minor groove, that is, towards the BHLH-loops (Supplementary Fig. 1 and Supplementary Videos 2 and 3). For DNA groove parameters, underwinding results in an increase in the major groove width and depth, and a decrease in the minor groove depth. The reverse trend is observed during overwinding. For BHLH-bound DNA, changes in both grooves are more noticeable for the flanking regions that accumulate most of the imposed torsional stress (Fig. 3), that is, the flanking sequences of the Myc-, Max_1-, and Mad sides, respectively.

Figure 4. Change in average axis bending of bp of the restrained DNA region (GTAGCACGTGCTAC) along the torsional regimes denoted with a colourbar.

Figure 5. Change in average depth and width of major and minor grooves of the restrained DNA region (GTAGCACGTGCTAC) along the torsional regimes denoted with a colourbar.

Protein-DNA contacts networks at different torsional stress regimes

We continue with the analysis of differences in the intermolecular contacts networks exploited by the three BHLH dimers. To recognise their DNA targets, the BHLH family utilises a five-residues motif (**xxExxR*) (De Masi et al., Reference De Masi, Grove, Vedenko, Alibés, Gisselbrecht, Serrano, Bulyk and AJM2011). For Myc, Mad, and Max the five-residues motif corresponds to HNxxExxRR (Fig. 1). Upon DNA binding, one of the monomers of the BHLH dimers forms further specific contacts with the E-box sequence, this includes Myc of MycMax, Mad of MadMax, and Max_1 monomer of MaxMax (Figs 1 and 6 and Supplementary Figs 16A–C and 17A–C). The other monomer interacts with DNA more nonspecifically. The Myc/Mad/Max_1 monomer shows nearly identical networks of specific intermolecular contacts (Fig. 6 and Supplementary Fig. 16A–C). In the torsionally relaxed state, from the five-residues motif (HNxxExxRR), histidine interacts specifically with the TG bp step on the opposite strand of the E-box half-site (CACG/CGTG); asparagine with the T base on the opposite strand of the E-box half-site (CACG/CGTG), glutamate with the CA bp step (CACG/CGTG) and the T base on the opposite strand of the E-box half-site (CACG/CGTG); first arginine with the CA bp step (CACG/CGTG) and the flanking sites; and second arginine with the central CG bp step on the opposite strand of the E-box half-site (GCACG/CGTG). Furthermore, the MadMax dimer has an additional specific contact, the Arg91 residue of the Mad loop interacts with the flanking TA step (GTAGCACG) from the minor groove (Supplementary Figs 16 and 17B), which explains the torsional rigidity of the step.

Figure 6. Specific contacts exploited by the five residues motif HNxxExxRR during the different torsional regimes.

The intermolecular specific interactions by the Max monomer, including Max of the MycMax and MadMax heterodimers, and Max_2 monomer of the Max-homodimer, follow to some extend the above-described specific contacts (Fig. 6 and Supplementary Figs 16 and 17). The differences include, for Max of MadMax and Max_2 of MaxMax, the Glu residue shows no interactions with the CA bp step; the first Arg residue interacts only with the flanking sites; for the MadMax dimer the second Arg residue oscillates between specific and nonspecific interactions with the CG bp step (Supplementary Fig. 16).

We further analyse the evolution of the strength of specific and nonspecific contacts, and the total number of protein-DNA contacts along the different torque regimes (Supplementary Figs 15 and 16). The analyses show that most of the protein-DNA contacts remain stable over the different degrees of torsional strain. There are, however, BHLH dimer- and torque-specific differences in the protein-DNA contacts that can explain the observed differences in DNA torque-induced deformations during the underwinding regime. Upon high level of underwinding (>−3°/bp) the His residue (HNxxExxRR) of the Max monomer of the MycMax heterodimer rearranges its orientation to hydrophobically interact with the T base (step (GTAGCACGTGCTAC) Supplementary Fig. 17A), which limits the torsional activity of the corresponding TA step, leading to a smaller change in the roll angle and the major groove width. This in addition to a greater number of nonspecific interactions from the Max side creates potential steric clashes that hinders DNA bending. Similarly, during the underwinding regime the nonspecific interactions that involve the His27 and Leu31 residues of Max_2 in the MaxMax homodimer, and the Ser 55–57 residues of Mad in the MadMax heterodimer prevent DNA bending from the corresponding sites.

There are also torque-specific changes in the protein-DNA specific interactions that have no impact on the observed torque-induced BHLH dimer-specific DNA deformations. Those include the Glu-A specific contacts by Max of MycMax and Mad of MadMax that become weaker upon underwinding (Supplementary Fig. 16), the second Arg-G specific contact for Mad and Max in MadMax that becomes stronger upon underwinding.

We also observe fluctuations in the ratio of the specific to nonspecific contacts and their strengths, which are linked to the flickering power of the long side chain residues, oscillating between interactions with DNA bases and backbone. The overall stability of the intermolecular contact networks reflects that the BHLH factors form mainly contacts with the E-box response element, while the imposed torque is predominantly absorbed by the flanking regions. Nevertheless, there are also, as discussed, some differences in the contacts between DNA flanking sites and the different proteins, which impact the distribution of the torsional stress and the observed DNA deformations.

Discussion

Our results show that homologous BHLH dimers, MycMax, MadMax and MaxMax can hinder the propagation of torsional stress along the genome by making the bound E-box sequence more torsionally rigid. Consequently, the imposed torque is accumulated at the flanking sites, resulting in the distinct BHLH dimer-specific DNA deformations during the underwinding regime. The negative torque-induced deformations, characterised by changes in DNA grooves geometry and an asymmetric bending of the E-box half side flanks, are more significant for MaxMax and MycMax DNA. The deformations occur at the Myc and Max_1 side, as these monomers form more base-specific contacts than their dimer partners, Max and Max_2, respectively. Despite experiencing the distinct deformations, the increase in DNA rigidity is relatively similar (see Supplementary Table 1). Here, we want to point out that we study only one DNA sequence; it is likely that the observed DNA deformations are sequence specific. In addition, the studied DNA sequence is relatively short, for longer DNA the deformations may show a different amplitude as well as localisation.

Our results allow us to hypothesise that the torque-induced BHLH dimer-specific DNA deformations can contribute to the TFs differential transcriptional responses by producing binding sites for distinct collaborative proteins. To validate our hypothesis, we explore potential binding partners of the BHLH dimers, using the ChIP-seq data available for Myc and Max TFs, using a window of ±100 bp from the DNA binding sites of the proteins of interest. It should be noted that ChIP-seq data is not single-base resolved and the protein co-binding may occur anywhere from 1 to 100 bp. Thus, the identified binding partners may be affected if they bind in relative proximity to the analysed TFs. Alternatively, the torque-induced deformation may propagate along DNA in a domino-like fashion, where it can facilitate (or inhibit) binding of a neighbour protein that in turn will continue to deform DNA and affect protein binding of the further away sites. The analysis reveals that among ten most frequent binding partners there are members of E2F, BZIP, and Zinc finger TFs families (Supplementary Fig. 18A,B). Additionally, previous studies also listed the TATA-box binding protein (Wei et al., Reference Wei, Resetca, Li, Johansson-Åkhe, Ahlner, Helander, Wallenhammar, Morad, Raught, Wallner, Kokubo, Tong, Penn and Sunnerhagen2019; Lourenco et al., Reference Lourenco, Resetca, Redel, Lin, AS, Ciaccio, TMG, Wei, Andrews, Sunnerhagen, Arrowsmith, Raught and Penn2021), TBP, as a frequent co-binder of the MycMax dimer. Interestingly, the TBP and the E2F-factors deform DNA in a similar fashion as the one we observe for the restrained Max_1 and Myc-flanks of MaxMax- and MycMax-DNA, respectively, during the underwinding regime. Thus, potentially the binding of the MycMax/MaxMax dimers could facilitate the binding of the TBP and E2F factors. For BZIPs and Zinc fingers, which induce no major conformational change of DNA but due to the flexibility of their DNA binding domains may associate with significantly deformed DNA (Patel et al., Reference Patel, Yang, Tinkham, Pradhan, Sun, Wang, Hoang, Wolf, Horton, Zhang, Macfarlan and Cheng2018; Hörberg and Reymer, Reference Hörberg and Reymer2020), the co-binding with MycMax/MaxMax may bring other mechanistic advantages. Based on our study of MafB, we know that BZIP factors can also hinder the propagation of torsional stress along DNA. Thus, the tandem binding of BHLH and BZIP factors could further enhance the transient accumulation of torsional stress, which could be necessary for the destabilisation of nucleosome core particles, the pre-initiation complex formation (Corless and Gilbert, Reference Corless and Gilbert2016), or DNA looping (Yan et al., Reference Yan, Leng, Finzi and Dunlap2018). The analyses of Myc (Supplementary Fig. 18A) and Max (Supplementary Fig. 18B) show both similar and different co-binding partners, which relates to the fact that Max forms both homodimers and heterodimers.

In summary, using atomistic microsecond range umbrella sampling simulations with the torsional restraint that controls DNA total twist, we have shown that BHLH TFs may hinder the propagation of torsional stress along DNA. When complexed with the homologous MycMax, MadMax and MaxMax dimers, DNA show a similar increase in the torsional rigidity but experience distinct torque-induced deformations, which may modulate the binding of collaborative TFs. We thus propose that changing torsional restraints on DNA may contribute to the differential transcriptional programs of homologous TFs.

Supplementary Materials

To view supplementary material for this article, please visit http://doi.org/10.1017/qrd.2022.5.

Data availability statement

All data generated and analysed in this study are available from the corresponding author upon request.

Acknowledgements

The authors thank Swedish National Infrastructure for Computing (SNIC) for the generous provision of computing resources.

Author contributions

J.H. and A.R. conceived and designed the study. J.H. performed the MD simulations. K.M. performed the bioinformatics analyses. J.H., K.M., and A.R. analysed the data. J.H. and A.R. wrote the article.

Financial support

This work was supported by the Swedish Foundation for Strategic Research SSF (grant number ITM170431).

Conflict of interest

The authors declare no conflicts of interest.

References

Abraham, MJ, Murtola, T, Schulz, R, Páll, S, Smith, JC, Hess, B and Lindahl, E (2015) GROMACS: High performance molecular simulations through multi-level parallelism from laptops to supercomputers. SoftwareX 1(2), 1925.CrossRefGoogle Scholar
Atchley, WR and Fitch, WM (1997) A natural classification of the basic helix–loop–helix class of transcription factors. Proceedings of the National Academy of Sciences of the United States of America 94(10), 51725176.CrossRefGoogle ScholarPubMed
Balaceanu, A, Buitrago, D, Walther, J, Hospital, A, Dans, PD and Orozco, M (2019) Modulation of the helical properties of DNA: Next-to-nearest neighbour effects and beyond. Nucleic Acids Research 47(24), 44184430.CrossRefGoogle ScholarPubMed
Berendsen, HJC, Postma, JPM, van Gunsteren, WF, DiNola, A and Haak, JR (1984) Molecular dynamics with coupling to an external bath. The Journal of Chemical Physics 81(8), 36843690.CrossRefGoogle Scholar
Boeger, H, Bushnell, DA, Davis, R, Griesenbeck, J, Lorch, Y, Strattan, JS, Westover, KD and Kornberg, RD (2005) Structural basis of eukaryotic gene transcription. FEBS Letters 579(4), 899903.CrossRefGoogle ScholarPubMed
Bonomi, M, Branduardi, D, Bussi, G, Camilloni, C, Provasi, D, Raiteri, P, Donadio, D, Marinelli, F, Pietrucci, F, Broglia, RA and Parrinello, M (2009) PLUMED: A portable plugin for free-energy calculations with molecular dynamics. Computer Physics Communications 180(10), 19611972.CrossRefGoogle Scholar
Corless, S and Gilbert, N (2016) Effects of DNA supercoiling on chromatin architecture. Biophysical Reviews 8(3), 245258.CrossRefGoogle ScholarPubMed
Dans, PD, Balaceanu, A, Pasi, M, Patelli, AS, Petkevičiūtė, D, Walther, J, Hospital, A, Bayarri, G, Lavery, R, Maddocks, JH and Orozco, M (2019) The static and dynamic structural heterogeneities of B-DNA: Extending Calladine–Dickerson rules. Nucleic Acids Research 47(21), 1109011102.CrossRefGoogle ScholarPubMed
Dans, PD, Pérez, A, Faustino, I, Lavery, R and Orozco, M (2012) Exploring polymorphisms in B-DNA helical conformations. Nucleic Acids Research 40(21), 1066810678.CrossRefGoogle ScholarPubMed
de Martin, X, Sodaei, R and Santpere, G (2021) Mechanisms of binding specificity among bHLH transcription factors. International Journal of Molecular Sciences 22, 9150. https://doi.org/10.3390/ijms22179150CrossRefGoogle ScholarPubMed
De Masi, F, Grove, CA, Vedenko, A, Alibés, A, Gisselbrecht, SS, Serrano, L, Bulyk, ML and AJM, Walhout (2011) Using a structural and logics systems approach to infer bHLH–DNA binding specificity determinants. Nucleic Acids Research 39(11), 45534563.CrossRefGoogle ScholarPubMed
Dennis, DJ, Han, S and Schuurmans, C (2019) bHLH transcription factors in neural development, disease, and reprogramming. Brain Research 1705, 4865.CrossRefGoogle Scholar
Diolaiti, D, McFerrin, L, Carroll, PA and Eisenman, RN (2015) Functional interactions among members of the MAX and MLX transcriptional network during oncogenesis. Biochimica et Biophysica Acta 1849(5), 484500.CrossRefGoogle ScholarPubMed
Dohnalová, H and Lankaš, F (2022) Deciphering the mechanical properties of B‐DNA duplex. WIREs Computational Molecular Science 12(3), e1575.CrossRefGoogle Scholar
Dunaway, M and Ostrander, EA (1993) Local domains of supercoiling activate a eukaryotic promoter in vivo. Nature 361(6414), 746748.CrossRefGoogle ScholarPubMed
Ferré-D’Amaré, AR, Prendergast, GC, Ziff, EB and Burley, SK (1993) Recognition by Max of its cognate DNA through a dimeric b/HLH/Z domain. Nature 363(6424), 3845.CrossRefGoogle ScholarPubMed
Fogg, JM, Judge, AK, Stricker, E, Chan, HL and Zechiedrich, L (2021) Supercoiling and looping promote DNA base accessibility and coordination among distant sites. Nature Communications 12(1), 5683.CrossRefGoogle ScholarPubMed
Giardino Torchia, ML and Ashwell, JD (2018) Getting MAD at MYC. Proceedings of the National Academy of Sciences 115(40), 98219823.CrossRefGoogle ScholarPubMed
Grandori, C, Cowley, SM, James, LP and Eisenman, RN (2000) The Myc/Max/Mad network and the transcriptional control of cell behavior. Annual Review of Cell and Developmental Biology 16(1), 653699.CrossRefGoogle ScholarPubMed
Hörberg, J, Moreau, K, Tamás, MJ and Reymer, A (2021) Sequence-specific dynamics of DNA response elements and their flanking sites regulate the recognition by AP-1 transcription factors. Nucleic Acids Research 49, 92809293. https://doi.org/10.1093/nar/gkab691CrossRefGoogle ScholarPubMed
Hörberg, J and Reymer, A (2018) A sequence environment modulates the impact of methylation on the torsional rigidity of DNA. Chemical Communications 54(84), 1188511888.CrossRefGoogle ScholarPubMed
Hörberg, J and Reymer, A (2020) Specifically bound BZIP transcription factors modulate DNA supercoiling transitions. Scientific Reports 10(1), 18795.CrossRefGoogle ScholarPubMed
Irobalieva, RN, Fogg, JM, Catanese, DJ Jr, Sutthibutpong, T, Chen, M, Barker, AK, Ludtke, SJ, Harris, SA, Schmid, MF, Chiu, W and Zechiedrich, L (2015) Structural diversity of supercoiled DNA. Nature Communications 6, 110.Google ScholarPubMed
Ivani, I, Dans, PD, Noy, A, Pérez, A, Faustino, I, Hospital, A, Walther, J, Andrio, P, Goñi, R, Balaceanu, A, Portella, G, Battistini, F, Gelpí, JL, González, C, Vendruscolo, M, Laughton, CA, Harris, SA, Case, DA and Orozco, M (2016) Parmbsc1: A refined force field for DNA simulations. Nature Methods 13(1), 5558.CrossRefGoogle ScholarPubMed
Kannan, S, Kohlhoff, K and Zacharias, M (2006) B-DNA under stress: Over- and untwisting of DNA during molecular dynamics simulations. Biophysical Journal 91(8), 29562965.CrossRefGoogle ScholarPubMed
Kouzine, F, Gupta, A, Baranello, L, Wojtowicz, D, Ben-Aissa, K, Liu, J, Przytycka, TM and Levens, D (2013) Transcription-dependent dynamic supercoiling is a short-range genomic force. Nature Structural & Molecular Biology 20(3), 396403.CrossRefGoogle ScholarPubMed
Kumar, S, Rosenberg, JM, Bouzida, D, Swendsen, RH and Kollman, PA (1992) THE weighted histogram analysis method for free-energy calculations on biomolecules. I. The method. Journal of Computational Chemistry 13(8), 10111021.CrossRefGoogle Scholar
Lankaš, F (2020) Simple, but not too simple: Modeling the dynamics of DNA and RNA buckling. Biophysical Journal 118(7), 15141516.CrossRefGoogle Scholar
Lavelle, C (2008) DNA torsional stress propagates through chromatin fiber and participates in transcriptional regulation. Nature Structural & Molecular Biology 15(2), 123125.CrossRefGoogle ScholarPubMed
Lavery, R, Moakher, M, Maddocks, JH, Petkeviciute, D and Zakrzewska, K (2009) Conformational analysis of nucleic acids revisited: Curves+. Nucleic Acids Research 37(17), 59175929.CrossRefGoogle ScholarPubMed
Lavery, R, Zakrzewska, K and Sklenar, H (1995) JUMNA (junction minimisation of nucleic acids). Computer Physics Communications 91(1), 135158.CrossRefGoogle Scholar
Liebl, K and Zacharias, M (2017) Unwinding induced melting of double-stranded DNA studied by free energy simulations. The Journal of Physical Chemistry B 121(49), 1101911030.CrossRefGoogle ScholarPubMed
Liebl, K and Zacharias, M (2020) How global DNA unwinding causes non-uniform stress distribution and melting of DNA. PLoS One 15(5), e0232976.CrossRefGoogle ScholarPubMed
Liebl, K and Zacharias, M (2021) Accurate modeling of DNA conformational flexibility by a multivariate Ising model. Proceedings of the National Academy of Sciences 118(15), e2021263118.CrossRefGoogle ScholarPubMed
Lin, QXX, Thieffry, D, Jha, S and Benoukraf, T (2020) TFregulomeR reveals transcription factors’ context-specific features and functions. Nucleic Acids Research 48(2), e10.CrossRefGoogle ScholarPubMed
Lourenco, C, Resetca, D, Redel, C, Lin, P, AS, MacDonald, Ciaccio, R, TMG, Kenney, Wei, Y, Andrews, DW, Sunnerhagen, M, Arrowsmith, CH, Raught, B and Penn, LZ (2021) MYC protein interactors in gene transcription and cancer. Nature Reviews Cancer 21(9), 579591.CrossRefGoogle ScholarPubMed
Ma, J, Bai, L and Wang, MD (2013) Transcription under torsion. Science 340(6140), 15801583.CrossRefGoogle ScholarPubMed
Maier, JA, Martinez, C, Kasavajhala, K, Wickstrom, L, Hauser, KE and Simmerling, C (2015) ff14SB: Improving the accuracy of protein side chain and backbone parameters from ff99SB. Journal of Chemical Theory and Computation 11(8), 36963713.CrossRefGoogle ScholarPubMed
Mark, P and Nilsson, L (2001) Structure and dynamics of the TIP3P, SPC, and SPC/E water models at 298 K. The Journal of Physical Chemistry A 105(43), 99549960.CrossRefGoogle Scholar
Mizutani, M, Ohta, T, Watanabe, H, Handa, H and Hirose, S (1991a) Negative supercoiling of DNA facilitates an interaction between transcription factor IID and the fibroin gene promoter. Proceedings of the National Academy of Sciences 88(3), 718722.CrossRefGoogle Scholar
Mizutani, M, Ura, K and Hirose, S (1991b) DNA superhelicity affects the formation of transcription preinitiation complex on eukaryotic genes differently. Nucleic Acids Research 19(11), 29072911.CrossRefGoogle Scholar
Muskhelishvili, G and Travers, A (2016) The regulatory role of DNA supercoiling in nucleoprotein complex assembly and genetic activity. Biophysical Reviews 8(S1), 522.CrossRefGoogle ScholarPubMed
Nair, SK and Burley, SK (2003) X-ray structures of Myc-Max and Mad-Max recognizing DNA: Molecular bases of regulation by proto-oncogenic transcription factors. Cell 112(2), 193205.CrossRefGoogle ScholarPubMed
Naughton, C, Avlonitis, N, Corless, S, … Gilbert, N (2013) Transcription forms and remodels supercoiling domains unfolding large-scale chromatin structures. Nature Structural & Molecular Biology 20(3), 387395.CrossRefGoogle ScholarPubMed
Noy, A, Sutthibutpong, T and Harris, SA (2016) Protein/DNA interactions in complex DNA topologies: Expect the unexpected. Biophysical Reviews 8(3), 233243.CrossRefGoogle ScholarPubMed
Osborne, CS, Chakalova, L, Brown, KE, Carter, D, Horton, A, Debrand, E, Goyenechea, B, Mitchell, JA, Lopes, S, Reik, W and Fraser, P (2004) Active genes dynamically colocalize to shared sites of ongoing transcription. Nature Genetics 36(10), 10651071.CrossRefGoogle ScholarPubMed
Ott, K, Martini, L, Lipfert, J and Gerland, U (2020) Dynamics of the buckling transition in double-stranded DNA and RNA. Biophysical Journal 118(7), 16901701.CrossRefGoogle ScholarPubMed
Parrinello, M and Rahman, A (1981) Polymorphic transitions in single crystals: A new molecular dynamics method. Journal of Applied Physics 52(12), 71827190.CrossRefGoogle Scholar
Pasi, M, Maddocks, JH, Beveridge, D, Bishop, TC, Case, DA, Cheatham, T III, Dans, PD, Jayaram, B, Lankas, F, Laughton, C, Mitchell, J, Osman, R, Orozco, M, Pérez, A, Petkeviciute, D, Spackova, N, Sponer, J, Zakrzewska, K and Lavery, R (2014) μABC: A systematic microsecond molecular dynamics study of tetranucleotide sequence effects in B-DNA. Nucleic Acids Research 42(19), 1227212283.CrossRefGoogle ScholarPubMed
Patel, A, Yang, P, Tinkham, M, Pradhan, M, Sun, M-A, Wang, Y, Hoang, D, Wolf, G, Horton, JR, Zhang, X, Macfarlan, T, Cheng, X (2018) DNA conformation induces adaptable binding by tandem zinc finger proteins. Cell, 173(1), 221233.e12.CrossRefGoogle ScholarPubMed
Pettersen, EF, Goddard, TD, Huang, CC, Couch, GS, Greenblatt, DM, Meng, EC and Ferrin, TE (2004) UCSF chimera—A visualization system for exploratory research and analysis. Journal of Computational Chemistry 25(13), 16051612.CrossRefGoogle ScholarPubMed
ALB, Pyne, Noy, A, KHS, Main, Velasco-Berrelleza, V, Piperakis, MM, Mitchenall, LA, Cugliandolo, FM, Beton, JG, CEM, Stevenson, Hoogenboom, BW, Bates, AD, Maxwell, A and Harris, SA (2021) Base-pair resolution analysis of the effect of supercoiling on DNA flexibility and major groove recognition by triplex-forming oligonucleotides. Nature Communications 12(1), 1053.Google Scholar
R Core Team (2013) R: A language and environment for statistical computing, Vienna: R Foundation for Statistical Computing.Google Scholar
Reymer, A, Zakrzewska, K and Lavery, R (2018) Sequence-dependent response of DNA to torsional stress: A potential biological regulation mechanism. Nucleic Acids Research 46(4), 16841694.CrossRefGoogle ScholarPubMed
Roe, DR and Cheatham, TE (2013) PTRAJ and CPPTRAJ: Software for processing and analysis of molecular dynamics trajectory data. Journal of Chemical Theory and Computation 9(7), 30843095.CrossRefGoogle ScholarPubMed
Schultz, MC, Brill, SJ, Ju, Q, Sternglanz, R and Reeder, RH (1992) Topoisomerases and yeast rRNA transcription: Negative supercoiling stimulates initiation and topoisomerase activity is required for elongation. Genes & Development 6(7), 13321341.CrossRefGoogle ScholarPubMed
Tabuchi, H and Hirose, S (1988) DNA supercoiling facilitates formation of the transcription initiation complex on the fibroin gene promoter. Journal of Biological Chemistry 263(30), 1528215287.CrossRefGoogle ScholarPubMed
Teves, SS and Henikoff, S (2014) Transcription-generated torsional stress destabilizes nucleosomes. Nature Structural & Molecular Biology 21(1), 8894.CrossRefGoogle ScholarPubMed
Torrie, GM and Valleau, JP (1977) Nonphysical sampling distributions in Monte Carlo free-energy estimation: Umbrella sampling. Journal of Computational Physics 23(2), 187199.CrossRefGoogle Scholar
Wei, Y, Resetca, D, Li, Z, Johansson-Åkhe, I, Ahlner, A, Helander, S, Wallenhammar, A, Morad, V, Raught, B, Wallner, B, Kokubo, T, Tong, Y, Penn, LZ and Sunnerhagen, M (2019) Multiple direct interactions of TBP with the MYC oncoprotein. Nature Structural & Molecular Biology 26(11), 10351043.CrossRefGoogle ScholarPubMed
Weintraub, H, Cheng, PF and Conrad, K (1986) Expression of transfected DNA depends on DNA topology. Cell 46(1), 115122.CrossRefGoogle ScholarPubMed
Yan, Y, Leng, F, Finzi, L and Dunlap, D (2018) Protein-mediated looping of DNA under tension requires supercoiling. Nucleic Acids Research 46(5), 23702379.CrossRefGoogle ScholarPubMed
Figure 0

Figure 1. (a) Sequence alignment of the basic helix–loop–helix domain of Myc, Max and Mad. (b) Crystal structure of MycMax-DNA (PDB ID: 1NKP), MadMax-DNA (PDB ID: 1NLW) and MaxMax-DNA (PDB ID: 1AN2) complexes bound to the E-Box element in red. For each complex, specific protein-DNA contacts seen in the crystal structures are highlighted. The Watson strand (5′– > 3′) is denoted with ‘w’ and the Crick (3′– > 5′) strand is denoted with ‘c’.

Figure 1

Figure 2. (a) PMF profiles showing the energy cost for twisting transitions for free and BHLH-bound DNA. (b) MycMax-, MadMax- and MaxMax induced DNA deformations are shown for (1) underwound regime, (2) torsionally relaxed regime and (3) overwound regime; with the restrained DNA region in red, MycMax in blue, MadMax in magenta, and MaxMax in pink. (c) DNA deformation energy of the restrained region (GTAGCACGTGCTAC, E-box response element in italics) calculated with a multivariate Ising model (Liebl and Zacharias, 2021).

Figure 2

Figure 3. Changes of bp twist angles for the restrained DNA-region in free and MycMax-, MadMax- and MaxMax-bound DNA as a function of the requested average change of twist per base pair step, indicated by a colourbar to the right.

Figure 3

Figure 4. Change in average axis bending of bp of the restrained DNA region (GTAGCACGTGCTAC) along the torsional regimes denoted with a colourbar.

Figure 4

Figure 5. Change in average depth and width of major and minor grooves of the restrained DNA region (GTAGCACGTGCTAC) along the torsional regimes denoted with a colourbar.

Figure 5

Figure 6. Specific contacts exploited by the five residues motif HNxxExxRR during the different torsional regimes.

Supplementary material: File

Hörberg et al. supplementary material

Hörberg et al. supplementary material

Download Hörberg et al. supplementary material(File)
File 18.8 MB

Review: Homologous BHLH transcription factors induce distinct deformations of torsionally-stressed DNA: a potential transcription regulation mechanism — R0/PR1

Conflict of interest statement

None.

Comments

Comments to Author: This paper describes a fascinating new mechanism for supercoiled-controlled DNA recognition, whereby bound proteins trap supercoils, thereby changing the twist of the DNA upstream, and changing the affinity of this site for a second DNA binding protein. Simulations have been performed at various levels of DNA twist using restrained MD in the presence of three related DNA binding proteins, and the sequence dependent absorption of the twist imposed carefully assessed, thereby demonstrating how these different proteins impede supercoiling. The simulations performed have been carefully described and the analysis thoughtfully executed, with detailed information including error bars presented as Supplementary Information. The addition of Chip-Seq analysis suggests the potential for binding partners of the proteins investigated to co-operatively associate in a manner that can be controlled by supercoiling. I find this proposed mechanism very compelling, and therefore recommend publication of this interesting paper.

I have one recommendation to improve the readability of the paper. The authors may consider including the full proteins investigated in Figure 1, ideally highlighting differences in sequence, as currently the reader only gets to see this information when they reach the section on DNA protein contacts, or if they look at Supplementary Figure 2 (which explains this very clearly). They may also wish to carefully check the legend to Figure 1, as I found the numbering and lettering somewhat confusing.

Review: Homologous BHLH transcription factors induce distinct deformations of torsionally-stressed DNA: a potential transcription regulation mechanism — R0/PR2

Conflict of interest statement

No conflict of interest.

Comments

Comments to Author: Hörberg et al. study structural effects of torsionally deforming DNA double helix with different transcription factors (TFs) bound to it by means of extensive umbrella sampling molecular dynamics (MD) simulations. In the cell, DNA is torsionally stressed during transcription, which comprises a major regulatory force in transcription regulation, operating via different mechanisms. In this work the authors demonstrate that in the presence of different TFs, the torsional stress induces different local structural changes to the DNA. The authors then hypothesize that these differences might have functional implications for transcription control, thus representing yet another regulatory mechanism, and give hints to support this view.

The work proceeds much along the lines of the authors’ prior publication (Hörberg and Reymer, Sci. Rep. 2020), where the hypothesis has already been formulated. In the present manuscript, the authors apply their approach to three more protein-DNA complexes with important TFs. Another innovation is that now the torsionally restrained region is wider than the protein binding site (4 flanking base pairs at each side), so that the effect on the flanking DNA can also be monitored.

My main concern is the following. The authors apply their torsional restraint and see TF-dependent structural changes within the protein binding site and the +/- 4 flanking pairs. Then they perform bioinformatics analysis using ChIP-seq data and find that each TF has different co-binders within +/- 100 bp around its binding site. The authors then hypothesize that the two phenomena are related, in particular they propose that torque-induced, protein-specific DNA deformations produce binding sites for the distinct co-binders (p. 11). However, the authors do not propose any plausible physical mechanism whereby the localized structural changes propagate as far as 100 bp away. There seems to be nothing in their data pointing to this possibility. The authors then focus on a specific example, the TBP and E2F factors. They mention (p. 11) that TBP and E2F deform DNA in a similar fashion as the one they observe, but no details are given, so it is hard to understand what they mean. Notice that e.g. TBP binds to the TATA-box (TATAAAA and its variants) which is 7 bp long, longer than the 4 flanking pairs modelled here. The authors should clarify these points.

Other issues:

Multiple times throughout the manuscript: use "respectively" instead of "correspondingly". Also, pay attention to the proper form of citations in the text ("Hörberg and Reymer" instead of "Johanna Hörberg and Reymer", etc.)

P. 2: The discussion about twist-absorbing dinucleotides is incomplete. Notice that if an inhomogeneous rod is torsionally stressed (below its buckling point), then its more flexible parts absorb more twist. This can be understood already in the framework of linear elasticity, by computing minimum energy twist distribution under the constraint of fixed total twist. The possible multiwell free energy landscape may (or may not) contribute to this, but multimodality is certainly not a prerequisite for the phenomenon. Please refer e.g. to a recent review on DNA elasticity (Dohnalova and Lankas, Wiley Interdiscip. Rev. Comput. Mol. Sci. 2021).

P. 2, bottom: The authors promise to investigate the relative positions of the TFs with respect to the nearest nucleosomes and transcription start sites, but nothing of this kind seems to be present in the manuscript.

P. 2, 5th line from below: as well ◊ as well as

P. 3, 2nd para: The restrained sets … ◊ The restraint sets …

P. 3, 2nd para: degrees^{-2} ◊ degree^{-2}

P. 3, MD simulation protocol: My understanding of the authors’ method to impose twist is that three base pairs at each side of the examined region are chosen to define the restraint. Please say which base pairs were chosen. Also say from which to which pair you define the twist between the handles (end-to-end twist). Perhaps it is defined between the middle pairs of each handle?

P. 3: It is very important to indicate the value of twist_ref and how it was obtained. Was twist_ref the same for all systems?

P. 3: There seem to be 10 windows for undertwisting and 10 for overtwisting, plus one for twist = twist_ref. That would make 10.5 microseconds, but you talk about 11.1 microseconds, please explain. Use the proper symbol for a microsecond.

P. 3-4, Elastic force constant analysis: The authors use a quadratic fit in the vicinity of the minimum for undertwisting and overtwisting individually. This does not seem to be correct. Indeed, this approach would assume a very strange free energy profile F(x) with a discontinuous second derivative at the minimum. Rather, one should consider a Taylor expansion of F(x) of the form

F(x) = F(x0) + F′(x0)(x - x0) + (1/2) F″(x0) (x - x0)^2 + …

Since one can choose F(x) = 0 (a constant added to the energy does not change the physical description) and F’(x0) = 0 since x0 is an extreme (a minimum), we see that the quadratic term is the first non-zero term in the expansion (it represents the so-called harmonic approximation). Thus, the authors should fit just one parabola on both sides close to the minimum, and then see how the profile deviates from this parabola for larger deformations. The deviations may then very well be different for under- and overtwisting.

P. 4, 2nd line from above: isotropic ◊ homogeneous

P. 4: Equation 2 is incorrect. In fact, the twist persistence length and twist stiffness are two different quantities, the first one being the decorrelation length of twist fluctuations. They are closely related for an intrinsically straight, homogeneous rod where twisting is decoupled from bending (twistable worm-like chain, or TWLC), where twist persistence length is twice the twist stiffness (see e.g. the review of Dohnalova and Lankas, WIRES 2021). To correct their presentation, the authors can just put C/k_BT instead of C in eq. 1, say that C is expressed in nanometers, and not talk about twist persistence length at all (and take eq. 2 out). Beware: in your equations, T means two different things!

P. 4: "A multivariate Ising model is used …" A citation is missing here. But more importantly, please describe in detail what you did. What kind of deformation energies - they are known from the umbrella sampling, no? So, say in all the detail what you used the Ising model for, which tool, with what parameters, what the exact protocol was, etc. This method is certainly not standard and we need all the information.

P. 4, Bioinformatics: corresponding ◊ corresponding to

P. 4, idem: the to the binding

P. 4, Results: impact ◊ impacts; towards same ◊ towards the same; paly ◊ play

P. 5: Supercoiling density in this case is (tw - tw_ref)/tw_ref, thus just 0.15, not 0.15 per bp step.

P. 5, B-DNA integrity. It is not enough to monitor stretch and opening - for instance, many bp breaks proceed via shear. The simplest way (also for the reader) is to monitor the HB distances directly, e.g. as in Figure S8 of Dohnalova et al., Compensatory mechanisms in temperature dependence … JCTC 2020.

P. 5: The authors say that the restraint range a. is potentially exaggerated, b. represents an approximation to the changes, and c. these changes are not known. Instead, please provide a serious discussion about the extent of the torsional strain during DNA transcription, including literature references, and relate it to your choice.

P. 5: Average twist per bp step. There seem to be two different meanings of the word "twist". It may mean the end-to-end twist defined between the restraining handles, or a local twist of individual bp steps. It is not clear what the authors mean here, please clarify. In this and other places, it would be useful to employ different notions, e.g. end-to-end twist, as opposed to local twist (or twist for short) - see e.g. Dohnalova and Lankas, WIRES 2021.

P. 5: Increased torsional rigidity. The observed increase depends on the length of the DNA under investigation. For instance, in the limit of very long DNA fragment, rigidifying its short part will have almost no effect on the overall stiffness. Here, the quantitative comparison with MafB is not quite fair, since MafB covers all the restrained region (see Figure 4 of Hörberg and Reymer, Sci. Rep. 2020), while here there are 4 bp (nearly) protein-free at each side.

P. 5: Structural effects of twisting. The authors provide this information for (presumably local) twist changes very nicely in Fig. 2. Figures analogous to Fig. 2 but for the other conformational parameters (roll, slide, …) should be added to SI. Are the reference values in Fig. 2 different in the four parts, or are they always those of the naked DNA? It is very interesting that the changes in Fig. 2 are sometimes not monotonic, e.g. in MadMax the twist of the 3rd step (AG first increases, then decreases and then stays the same). Is it real, or just a lack of convergence (e.g. due to flickering protein contacts)? Similarly for the central CG of MaxMax.

P. 5 bottom: Deformation energy, Ising model. It is not clear at all what is going on here, please specify in detail. The deformation energies in Figure 1 have large error bars (with as yet unclear meaning) which mostly overlap each other, so they should be interpreted with caution. Please clarify.

P. 6, Figure 1: Parts B and C are interchanged.

P. 6, steps excluded from the analysis: these steps are present in Figures 2 and S8-S13. Perhaps they could stay there.

P. 7, "behaviour of other parameters follow earlier reports": which reports and in what sense?

P. 7, axis bending (not axes or ax): How is it defined? The bending in Fig. 3 refers to individual pairs, while Fig. S4 seems to show bending for the whole region. Please specify. Include units in Fig. 3.

P. 7, bending towards major/minor groove. A mere bending angle (Figs. 3 and S4) does not say anything about bending direction. How was the direction determined?

P. 7-8: The last sentence of the subsection is incomprehensible, please reformulate. Fig. 4: include units.

P. 9-10, protein-DNA interactions: It would be fair to mention explicitly that in some cases the protein interacts also outside the E-box, i.e. with the flanking sequence, which can then affect the torsional response of these regions.

P. 11, Discussion: see the beginning of this report. I would also suggest to put the bioinformatics findings into a new short subsection within Results, and leave the Discussion for their interpretation.

Supplement: Pay attention to the readability of the figures, inclusion of units, more complete descriptions in the captions of what is in the figure. I suggest to put Figures S8 to S13 each at one page in the landscape format. The current ones are nearly unreadable.

Decision: Homologous BHLH transcription factors induce distinct deformations of torsionally-stressed DNA: a potential transcription regulation mechanism — R0/PR3

Comments

Comments to Author: Reviewer #1: Hörberg et al. study structural effects of torsionally deforming DNA double helix with different transcription factors (TFs) bound to it by means of extensive umbrella sampling molecular dynamics (MD) simulations. In the cell, DNA is torsionally stressed during transcription, which comprises a major regulatory force in transcription regulation, operating via different mechanisms. In this work the authors demonstrate that in the presence of different TFs, the torsional stress induces different local structural changes to the DNA. The authors then hypothesize that these differences might have functional implications for transcription control, thus representing yet another regulatory mechanism, and give hints to support this view.

The work proceeds much along the lines of the authors’ prior publication (Hörberg and Reymer, Sci. Rep. 2020), where the hypothesis has already been formulated. In the present manuscript, the authors apply their approach to three more protein-DNA complexes with important TFs. Another innovation is that now the torsionally restrained region is wider than the protein binding site (4 flanking base pairs at each side), so that the effect on the flanking DNA can also be monitored.

My main concern is the following. The authors apply their torsional restraint and see TF-dependent structural changes within the protein binding site and the +/- 4 flanking pairs. Then they perform bioinformatics analysis using ChIP-seq data and find that each TF has different co-binders within +/- 100 bp around its binding site. The authors then hypothesize that the two phenomena are related, in particular they propose that torque-induced, protein-specific DNA deformations produce binding sites for the distinct co-binders (p. 11). However, the authors do not propose any plausible physical mechanism whereby the localized structural changes propagate as far as 100 bp away. There seems to be nothing in their data pointing to this possibility. The authors then focus on a specific example, the TBP and E2F factors. They mention (p. 11) that TBP and E2F deform DNA in a similar fashion as the one they observe, but no details are given, so it is hard to understand what they mean. Notice that e.g. TBP binds to the TATA-box (TATAAAA and its variants) which is 7 bp long, longer than the 4 flanking pairs modelled here. The authors should clarify these points.

Other issues:

Multiple times throughout the manuscript: use "respectively" instead of "correspondingly". Also, pay attention to the proper form of citations in the text ("Hörberg and Reymer" instead of "Johanna Hörberg and Reymer", etc.)

P. 2: The discussion about twist-absorbing dinucleotides is incomplete. Notice that if an inhomogeneous rod is torsionally stressed (below its buckling point), then its more flexible parts absorb more twist. This can be understood already in the framework of linear elasticity, by computing minimum energy twist distribution under the constraint of fixed total twist. The possible multiwell free energy landscape may (or may not) contribute to this, but multimodality is certainly not a prerequisite for the phenomenon. Please refer e.g. to a recent review on DNA elasticity (Dohnalova and Lankas, Wiley Interdiscip. Rev. Comput. Mol. Sci. 2021).

P. 2, bottom: The authors promise to investigate the relative positions of the TFs with respect to the nearest nucleosomes and transcription start sites, but nothing of this kind seems to be present in the manuscript.

P. 2, 5th line from below: as well ◊ as well as

P. 3, 2nd para: The restrained sets … ◊ The restraint sets …

P. 3, 2nd para: degrees^{-2} ◊ degree^{-2}

P. 3, MD simulation protocol: My understanding of the authors’ method to impose twist is that three base pairs at each side of the examined region are chosen to define the restraint. Please say which base pairs were chosen. Also say from which to which pair you define the twist between the handles (end-to-end twist). Perhaps it is defined between the middle pairs of each handle?

P. 3: It is very important to indicate the value of twist_ref and how it was obtained. Was twist_ref the same for all systems?

P. 3: There seem to be 10 windows for undertwisting and 10 for overtwisting, plus one for twist = twist_ref. That would make 10.5 microseconds, but you talk about 11.1 microseconds, please explain. Use the proper symbol for a microsecond.

P. 3-4, Elastic force constant analysis: The authors use a quadratic fit in the vicinity of the minimum for undertwisting and overtwisting individually. This does not seem to be correct. Indeed, this approach would assume a very strange free energy profile F(x) with a discontinuous second derivative at the minimum. Rather, one should consider a Taylor expansion of F(x) of the form

F(x) = F(x0) + F’(x0)(x - x0) + (1/2) F’’(x0) (x - x0)^2 + …

Since one can choose F(x) = 0 (a constant added to the energy does not change the physical description) and F’(x0) = 0 since x0 is an extreme (a minimum), we see that the quadratic term is the first non-zero term in the expansion (it represents the so-called harmonic approximation). Thus, the authors should fit just one parabola on both sides close to the minimum, and then see how the profile deviates from this parabola for larger deformations. The deviations may then very well be different for under- and overtwisting.

P. 4, 2nd line from above: isotropic ◊ homogeneous

P. 4: Equation 2 is incorrect. In fact, the twist persistence length and twist stiffness are two different quantities, the first one being the decorrelation length of twist fluctuations. They are closely related for an intrinsically straight, homogeneous rod where twisting is decoupled from bending (twistable worm-like chain, or TWLC), where twist persistence length is twice the twist stiffness (see e.g. the review of Dohnalova and Lankas, WIRES 2021). To correct their presentation, the authors can just put C/k_BT instead of C in eq. 1, say that C is expressed in nanometers, and not talk about twist persistence length at all (and take eq. 2 out). Beware: in your equations, T means two different things!

P. 4: "A multivariate Ising model is used …" A citation is missing here. But more importantly, please describe in detail what you did. What kind of deformation energies - they are known from the umbrella sampling, no? So, say in all the detail what you used the Ising model for, which tool, with what parameters, what the exact protocol was, etc. This method is certainly not standard and we need all the information.

P. 4, Bioinformatics: corresponding ◊ corresponding to

P. 4, idem: the to the binding

P. 4, Results: impact ◊ impacts; towards same ◊ towards the same; paly ◊ play

P. 5: Supercoiling density in this case is (tw - tw_ref)/tw_ref, thus just 0.15, not 0.15 per bp step.

P. 5, B-DNA integrity. It is not enough to monitor stretch and opening - for instance, many bp breaks proceed via shear. The simplest way (also for the reader) is to monitor the HB distances directly, e.g. as in Figure S8 of Dohnalova et al., Compensatory mechanisms in temperature dependence … JCTC 2020.

P. 5: The authors say that the restraint range a. is potentially exaggerated, b. represents an approximation to the changes, and c. these changes are not known. Instead, please provide a serious discussion about the extent of the torsional strain during DNA transcription, including literature references, and relate it to your choice.

P. 5: Average twist per bp step. There seem to be two different meanings of the word "twist". It may mean the end-to-end twist defined between the restraining handles, or a local twist of individual bp steps. It is not clear what the authors mean here, please clarify. In this and other places, it would be useful to employ different notions, e.g. end-to-end twist, as opposed to local twist (or twist for short) - see e.g. Dohnalova and Lankas, WIRES 2021.

P. 5: Increased torsional rigidity. The observed increase depends on the length of the DNA under investigation. For instance, in the limit of very long DNA fragment, rigidifying its short part will have almost no effect on the overall stiffness. Here, the quantitative comparison with MafB is not quite fair, since MafB covers all the restrained region (see Figure 4 of Hörberg and Reymer, Sci. Rep. 2020), while here there are 4 bp (nearly) protein-free at each side.

P. 5: Structural effects of twisting. The authors provide this information for (presumably local) twist changes very nicely in Fig. 2. Figures analogous to Fig. 2 but for the other conformational parameters (roll, slide, …) should be added to SI. Are the reference values in Fig. 2 different in the four parts, or are they always those of the naked DNA? It is very interesting that the changes in Fig. 2 are sometimes not monotonic, e.g. in MadMax the twist of the 3rd step (AG first increases, then decreases and then stays the same). Is it real, or just a lack of convergence (e.g. due to flickering protein contacts)? Similarly for the central CG of MaxMax.

P. 5 bottom: Deformation energy, Ising model. It is not clear at all what is going on here, please specify in detail. The deformation energies in Figure 1 have large error bars (with as yet unclear meaning) which mostly overlap each other, so they should be interpreted with caution. Please clarify.

P. 6, Figure 1: Parts B and C are interchanged.

P. 6, steps excluded from the analysis: these steps are present in Figures 2 and S8-S13. Perhaps they could stay there.

P. 7, "behaviour of other parameters follow earlier reports": which reports and in what sense?

P. 7, axis bending (not axes or ax): How is it defined? The bending in Fig. 3 refers to individual pairs, while Fig. S4 seems to show bending for the whole region. Please specify. Include units in Fig. 3.

P. 7, bending towards major/minor groove. A mere bending angle (Figs. 3 and S4) does not say anything about bending direction. How was the direction determined?

P. 7-8: The last sentence of the subsection is incomprehensible, please reformulate. Fig. 4: include units.

P. 9-10, protein-DNA interactions: It would be fair to mention explicitly that in some cases the protein interacts also outside the E-box, i.e. with the flanking sequence, which can then affect the torsional response of these regions.

P. 11, Discussion: see the beginning of this report. I would also suggest to put the bioinformatics findings into a new short subsection within Results, and leave the Discussion for their interpretation.

Supplement: Pay attention to the readability of the figures, inclusion of units, more complete descriptions in the captions of what is in the figure. I suggest to put Figures S8 to S13 each at one page in the landscape format. The current ones are nearly unreadable.

Reviewer #2: This paper describes a fascinating new mechanism for supercoiled-controlled DNA recognition, whereby bound proteins trap supercoils, thereby changing the twist of the DNA upstream, and changing the affinity of this site for a second DNA binding protein. Simulations have been performed at various levels of DNA twist using restrained MD in the presence of three related DNA binding proteins, and the sequence dependent absorption of the twist imposed carefully assessed, thereby demonstrating how these different proteins impede supercoiling. The simulations performed have been carefully described and the analysis thoughtfully executed, with detailed information including error bars presented as Supplementary Information. The addition of Chip-Seq analysis suggests the potential for binding partners of the proteins investigated to co-operatively associate in a manner that can be controlled by supercoiling. I find this proposed mechanism very compelling, and therefore recommend publication of this interesting paper.

I have one recommendation to improve the readability of the paper. The authors may consider including the full proteins investigated in Figure 1, ideally highlighting differences in sequence, as currently the reader only gets to see this information when they reach the section on DNA protein contacts, or if they look at Supplementary Figure 2 (which explains this very clearly). They may also wish to carefully check the legend to Figure 1, as I found the numbering and lettering somewhat confusing.

Decision: Homologous BHLH transcription factors induce distinct deformations of torsionally-stressed DNA: a potential transcription regulation mechanism — R1/PR4

Comments

No accompanying comment.

Decision: Homologous BHLH transcription factors induce distinct deformations of torsionally-stressed DNA: a potential transcription regulation mechanism — R2/PR5

Comments

No accompanying comment.