Prion disease in cattle was called bovine spongiform encephalopathy (BSE) and was first recognised in the United Kingdom in 1986 (Bradley et al. Reference Bradley, Collee and Liberski2006). BSE shares common features with Creutzfeldt–Jakob disease (CJD) showing scrapie like spongiform vacuolation of brain tissue and accumulation of the scrapie form of prion protein, PrPSc (Wood et al. Reference Wood, McGill, Done and Bradley1997; Aguzzi & Heikenwalder, Reference Aguzzi and Heikenwalder2006). In humans and sheep, prion protein gene (PRNP) acts as a major genetic factor in prion diseases. Met/Met genotype of human PRNP codon 129 is susceptible to CJD in human, and haplotypes of ovine PRNP codons 136, 154 and 171 are significantly associated with susceptibility to scrapie in sheep (Hunter et al. Reference Hunter, Goldmann, Foster, Cairns and Smith1997; Jeong et al. Reference Jeong, Lee, Kim, Jin, Kim, Carp and Kim2005b; Groschup et al. Reference Groschup, Lacroux, Buschmann, Luhken, Mathey, Eiden, Lugan, Hoffmann, Espinosa, Baron, Torres, Erhardt and Andreoletti2007; Jeong & Kim, Reference Jeong and Kim2014). Similarly, BSE-affected cattle show higher distributions of 23 bp deletion in the PRNP promoter region and 12 bp deletion in the PRNP intron region than healthy cattle (Jeong et al. Reference Jeong, Lee, Kim, Carp and Kim2006; Haase et al. Reference Haase, Doherr, Seuberlich, Drogemuller, Dolf, Nicken, Schiebel, Ziegler, Groschup, Zurbriggen and Leeb2007). Recent studies suggested that single nucleotide polymorphism (SNP) 4136 and 13 861 in the non-coding region of bovine PRNP gene are related to BSE susceptibility (Murdoch et al. Reference Murdoch, Clawson, Laegreid, Stothard, Settles, McKay, Prasad, Wang, Moore and Williams2010a, Reference Murdoch, Clawson, Yue, Basu, McKay, Settles, Capoferri, Laegreid, Williams and Mooreb; Jeong et al. Reference Jeong, Jin, Carp and Kim2013). However, the frequency of PRNP Met/Met genotype in Korean population is approximately three times higher than that in British population, but the incidence of sporadic CJD is somewhat similar (Brandel et al. Reference Brandel, Preece, Brown, Croes, Laplanche, Agid, Will and Alperovitch2003; Nurmi et al. Reference Nurmi, Bishop, Strain, Brett, McGuigan, Hutchison, Farrell, Tilvis, Erkkila, Simell, Knight and Haltia2003; Jeong et al. Reference Jeong, Lee, Kim, Jin, Kim, Carp and Kim2005b; Jeong & Kim, Reference Jeong and Kim2014). In addition, the same PRNP gene transgenic mouse has different disease incubation times (Lloyd et al. Reference Lloyd, Onwuazor, Beck, Mallinson, Farrall, Targonski, Collinge and Fisher2001), indicating that other factors besides the PRNP gene may contribute to the progression of prion diseases.
In recent studies, human prion diseases showed association with prion-like protein gene (PRND) polymorphisms. Among several polymorphisms, T174M polymorphism in the coding region and polymorphisms at the 3′ untranslated region (UTR) are significantly related to human prion diseases (Mead et al. Reference Mead, Beck, Dickinson, Fisher and Collinge2000; Peoc'h et al. Reference Peoc'h, Guerin, Brandel, Launay and Laplanche2000; Croes et al. Reference Croes, Alizadeh, Bertoli-Avella, Rademaker, Vergeer-Drop, Dermaut, Houwing-Duistermaat, Wientjens, Hofman, Van Broeckhoven and van Duijn2004; Jeong et al. Reference Jeong, Kim, Choi, Lee, Song, Kim, Carp and Kim2005a). In addition, codon 26 of PRND gene is related with susceptibility to scrapie in sheep (Mesquita et al. Reference Mesquita, Batista, Marques, Santos, Pimenta, Silva Pereira, Carolino, Santos Silva, Oliveira Sousa, Gama, Fontes, Horta, Prates and Pereira2010). Two studies in cattle have identified relationships between BSE and PRND genotype. The PRND genotype differs significantly between healthy cattle and BSE cattle of the Fleckvieh breed in Germany (Balbus et al. Reference Balbus, Humeny, Kashkevich, Henz, Fischer, Becker and Schiebel2005). UK cattle also showed different haplotype distribution between healthy cattle and BSE cattle (Comincini et al. Reference Comincini, Foti, Tranulis, Hills, Di Guardo, Vaccari, Williams, Harbitz and Ferretti2001).
The purpose of this study was to assess the susceptibility of Korean native cattle (Hanwoo) and Korean dairy cattle (Holstein) to BSE. Thus, we investigated the PRND genotype, allele and haplotype frequencies of SNPs in 124 Korean Holstein and 277 Hanwoo and compared the distribution of PRND genotype between Korean cattle and BSE cattle from the previous study.
Material and methods
Genetic analysis
Peripheral blood samples from 277 Hanwoo and 124 Holstein cattle in South Korea were obtained in ethylenediaminetetraacetic acid (EDTA) tubes. Genomic DNA was extracted from 200 µl peripheral blood sample using DNA blood mini kit (Qiagen, USA) according to the manufacturer's instructions. Polymerase chain reaction (PCR) was carried out with the following forward and reverse primers: Bovine PRND-F (GAGACTCAGAACTCCACTGA) and Bovine PRND-R (TGCTCTTTGGTACCTTCAGA). The genomic DNA sequence of PRND gene was obtained from GenBank (Gene ID: 281426) and PCR primers were designed to amplify the open reading frame (ORF) of the gene. Each reaction mixture contained 50 pmole of each primer, 5 µl of 10 × Taq DNA polymerase buffer, 1 µl of 10 mm dNTP mixture, 2·5 units of Taq DNA polymerase (Promega, USA) and nuclease-free water to a total volume of 25 µl. The PCR cycling parameters were as follows: denaturing at 95 °C for 2 min, followed by 35 cycles of 95 °C for 20 s, 59 °C for 40 s, and 72 °C for 2 min, and then 1 cycle of 72 °C for 10 min for final extension using an S-1000 Thermal Cycler (Bio-Rad Laboratories, USA). The PCR products for automatic DNA sequencing were prepared using a gel extraction kit (Qiagen, USA). Purified PCR products were directly sequenced with an ABI 3730 Capillary Sequencer (ABI, USA).
Statistical analysis
All statistical analyses were calculated using Statistical Analysis Software version 9.3 (SAS Institute, Cary, NC, USA). We also examined Lewontin's D′ (|D′|) between five SNPs of PRND gene in Hanwoo and Holstein cattle. Hardy-Weinberg Equilibrium (HWE) test and haplotype analysis were performed using SNP Analyser TM 2.0 (http://snp.istech.info/istech/board/ detail_snpa2.jsp). The susceptibility to BSE was compared across genotype using the Chi-square test. P value < 0·05 was considered as statistically significant.
Results
The bovine PRND gene is composed of two exons. To examine the genotype and allele frequencies of PRND SNPs in Korean Holstein and Hanwoo cattle, we investigated SNPs within exon 2 including ORF of bovine PRND gene by direct sequencing of the genomic DNA of 277 Hanwoo and 124 Holstein cattle. A total of five SNPs were detected including PRND 149G > A (p.50Arg > His; R50H), PRND c.285C > T (C4819T), PRND c.395G > A (p.132Arg > Gln; R132Q) and PRND c.528T > A (T5063A) in the ORF and c.602C > G in the 3′ UTR of exon 2. The differences of genotype and allele frequencies of the five PRND polymorphisms are described in Table 1. The genotype frequencies of all five SNPs followed HWE in the Hanwoo. In the Korean Holstein, two SNPs, c.285C > T and c.528T > A were not in HWE (P = 0·033), the other three SNPs were in HWE.
Genotype and allele frequencies of PRND polymorphisms in Korean Hanwoo and Holstein cattle

To evaluate the susceptibility to BSE in Korean Holstein and Hanwoo cattle, we compared the genotype frequency of PRND c.395G > A (p.132 Arg > Gln; R132Q) polymorphism between BSE-affected German cattle (data from Balbus et al. Reference Balbus, Humeny, Kashkevich, Henz, Fischer, Becker and Schiebel2005, used with permission: online Supplementary File) and Korean cattle (Fig. 1). A significant difference in genotype distribution of c.395G > A SNP was previously shown between BSE-affected and healthy German Fleckvieh cattle (Balbus et al. Reference Balbus, Humeny, Kashkevich, Henz, Fischer, Becker and Schiebel2005). However, there were no significant differences in genotype distribution of this SNP between BSE-affected German cattle and Korean Holstein cattle (P = 0·6778). A significant difference in genotype distribution was detected between BSE-German cattle and Hanwoo cattle (P = 0·0028).
Genotype comparison of c.395G > A (p.132 Arg > Gln; R132Q) polymorphism of prion-like protein gene (PRND) in BSE-affected German cattle† and Korean cattle. GR FV BSE: BSE-affected German Fleckvieh cattle; GR FV Healthy: Healthy German Fleckvieh cattle; KR HW Healthy: Healthy Korean native cattle (Hanwoo); KR HL Healthy: Healthy Korean dairy cattle (Holstein). Parentheses indicate the sample numbers of cattle. Asterisks indicate statistically significant differences of genotype distribution between BSE-affected cattle and Healthy cattle. **P < 0·001. †Data from Balbus et al. (Reference Balbus, Humeny, Kashkevich, Henz, Fischer, Becker and Schiebel2005), used with permission: online Supplementary File.

To examine whether there was a strong linkage disequilibrium (LD) among the five SNPs, LD coefficient (|D′|) was calculated in the SNPs of Korean Holstein and Hanwoo cattle. The results indicated a weak LD for c.149G > A with c.285C > T, c.395G > A, c.528T > A and c.602C > G. The remaining 4 SNPs showed a strong LD with D′ value 0·970–1·0 (Table 2).
Linkage Disequilibrium (LD) among five single nucleotide polymorphisms (SNPs) of PRND gene in Korean Hanwoo and Holstein cattle

Analysis of haplotype frequency was carried out for Korean Holstein and Hanwoo cattle. As shown in Table 3, among the six haplotypes, GCATG haplotype was observed more frequently (51·2% for the Hanwoo; 70·7% for the Korean Holstein). The haplotype frequencies of GCATG, GTGAC, GCGTC, ATGAC and ACATG revealed substantial differences between Korean Holstein and Hanwoo cattle.
Haplotype frequency of five PRND polymorphisms in Korean Hanwoo and Holstein cattle

† Others contain rare haplotypes with frequency <0·001.
Discussion
PRNP is considered a major genetic factor of several prion diseases including scrapie, CJD and BSE. A significant difference in insertion/deletion (in/del) genotype frequencies of bovine PRNP gene has been found in the promoter and intron regions between BSE-affected cattle and healthy cattle. These two polymorphisms are associated with transcription factor binding site of RP58 and SP1; in addition, follow-up studies confirm that the polymorphisms are related to the expression level of cellular prion protein (PrPC). Since prion expression level is associated with the incubation period of disease onset, it is concluded that these two polymorphisms are associated with BSE progression (Sander et al. Reference Sander, Hamann, Drogemuller, Kashkevich, Schiebel and Leeb2005). In addition, a previous study identified the PRNP ORF mutation, E211K, which is potentially associated with the familial form of BSE (Nicholson et al. Reference Nicholson, Brunelle, Richt, Kehrli and Greenlee2008). This mutation, located in codon 211 of the bovine PRNP gene, is in a region homologous with codon 200 of human PRNP. Since the major form of familial CJD is caused by the E200K mutation (Jeong & Kim, Reference Jeong and Kim2014; Cohen et al. Reference Cohen, Chapman, Korczyn, Nitsan, Appel, Hoffmann, Rosenmann, Kahana and Lee2015), E211K mutation in cattle can act as the genetic factor of the putative inherited form of BSE. Several attempts to identify this mutation in the germline have been unsuccessful thus far (Heaton et al. Reference Heaton, Keele, Harhay, Richt, Koohmaraie, Wheeler, Shackelford, Casas, King, Sonstegard, Van Tassell, Neibergs, Chase, Kalbfleisch, Smith, Clawson and Laegreid2008; Zhao et al. Reference Zhao, Wang, Zou and Zhang2010; Kim & Jeong, Reference Kim and Jeong2017).
Recent studies have focused on the PRND gene, paralogue of PRNP. PRND is located 25·9 kb downstream of PRNP and encodes the prion-like protein, doppel. Doppel, an N-terminal truncated form of the PrPC is composed of 178 amino acids (Golaniska et al. Reference Golaniska, Flirski and Liberski2004). Because of biochemical and structural similarity with PRNP, several PRND SNPs were investigated and analysed for association with BSE. Comincini and Balbus conducted a BSE case-control study on the PRND gene in British and German cattle. In British Friesian cattle, the R50H N110N R132R genotype frequency was different between BSE-affected cattle and healthy cattle (Comincini et al. Reference Comincini, Foti, Tranulis, Hills, Di Guardo, Vaccari, Williams, Harbitz and Ferretti2001). In German Fleckvieh cattle, the distribution of genotype C4815T and R132Q was significantly different between BSE-affected cattle and healthy cattle (Balbus et al. Reference Balbus, Humeny, Kashkevich, Henz, Fischer, Becker and Schiebel2005). Among several PRND polymorphisms, we are interested in the nonsynonymous polymorphism, R132Q, since this polymorphism can cause conformational change of the peptide and shows statistically significant association with BSE. We tried to evaluate the susceptibility to BSE in Korean Holstein and Hanwoo cattle by comparing the genotype distribution of R132Q. Hanwoo cattle showed statistically different genotype distribution as compared to BSE-affected cattle (P < 0·05), whereas Korean Holstein cattle showed similar genotype distribution with BSE-affected cattle (P > 0·05) (Fig. 1). This implies that the Hanwoo possesses a relatively more BSE-resistant genotype than the Korean Holstein. Our previous study on the PRNP gene showed that the resistant allele distribution of 23 bp in/del polymorphism of the promoter region in Hanwoo cattle was higher than that in Korean Holstein cattle (Jeong et al. Reference Jeong, Lee, Kim, Carp and Kim2006). These results suggested that the Hanwoo possess more resistant genotypes in two major members of the prion gene family, PRNP and PRND. However, the SNP studies did not show the identical results in cattle of all breeds, and was performed in relatively limited sample groups. Therefore, these SNPs should be assessed in a large BSE-affected group and various cattle breeds in the future.
PRND polymorphisms showed a propensity toward susceptibility to various types of prion diseases in several species (Comincini et al. Reference Comincini, Foti, Tranulis, Hills, Di Guardo, Vaccari, Williams, Harbitz and Ferretti2001; Croes et al. Reference Croes, Alizadeh, Bertoli-Avella, Rademaker, Vergeer-Drop, Dermaut, Houwing-Duistermaat, Wientjens, Hofman, Van Broeckhoven and van Duijn2004; Balbus et al. Reference Balbus, Humeny, Kashkevich, Henz, Fischer, Becker and Schiebel2005; Jeong et al. Reference Jeong, Kim, Choi, Lee, Song, Kim, Carp and Kim2005a; Mesquita et al. Reference Mesquita, Batista, Marques, Santos, Pimenta, Silva Pereira, Carolino, Santos Silva, Oliveira Sousa, Gama, Fontes, Horta, Prates and Pereira2010). In addition, doppel was localised in the dystrophic neurites of senile plaques in Alzheimer's disease (AD) (Ferrer et al. Reference Ferrer, Freixas, Blanco, Carmona and Puig2004), and PRND polymorphism at the 3′ UTR was associated with several phenotypes such as increased cumulative behavioural load and an elevated risk for delusions, anxiety, agitation/aggression, apathy and irritability/emotional ability in AD patients (Flirski et al. Reference Flirski, Sieruta, Golanska, Kloszewska, Liberski and Sobow2012). Moreover, the ectopic expression of doppel was toxic in neuronal cells but not in spermatogenic cells (Qin et al. Reference Qin, Ding, Xiao, Ma, Wang, Gao and Zhao2013). Thus, further investigation on the association between doppel and neurodegenerative diseases is needed in the future.
In conclusion, the analysis of the bovine PRND polymorphisms in Korean cattle revealed that the genotype frequency of PRND c.395G > A (p.132 Arg > Gln; R132Q) in Hanwoo was significantly different from that in Korean Holstein and from that previously reported in BSE-affected German cattle. It suggests that Hanwoo have a genotype that is relatively resistant to BSE. Our data will help to predict the BSE susceptibility based on the SNP of the bovine PRND gene in Korean cattle.
Supplementary material
The supplementary material for this article can be found at https://doi.org/10.1017/S0022029917000814.
This research was supported by the Basic Science Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (2015R1D1A1A010599). This research was also supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (2017R1A6A1A03015876). Mr. Y.-C. Kim was supported by the BK21 Plus program in the Department of Bioactive Material Sciences.
Conflict of interest
The authors declare that there are no conflicts of interest.



