Introduction
The genus Trachactinolaimus Andrássy, Reference Andrássy1963 is an interesting dorylaimid (order Dorylaimida) nematode taxon, which displays low diversity and very vast geographical distribution as, at present, it includes five species, known to occur in four continents. Andrássy (Reference Andrássy1963) created this genus to accommodate a new (and the type) species, T. radulatus, inhabiting moss habitats in Angola. Much later, Vinciguerra (Reference Vinciguerra1988) transferred Paractinolaimus dominicus Hunt, Reference Hunt1978 from Dominica to this genus; Wu and Liang (Reference Wu and Liang1999) described T. brevicaudatus, collected in soil samples from China; Eliava and Jgenti (Reference Eliava and Jgenti2006) discovered T. montanus in a Georgian forest; and, very recently, Zhang et al. (Reference Zhang, Ji, Guo, Qing and Li2023) found T. nanjingensis associated with mosses in China.
Since its original description the concept of the genus was not modified in any substantial aspect. As a member of the family Actinolaimidae, it is characterized and easily recognizable by the long, filiform tail of both sexes and the presence of abundant small denticles in its cheilostom. Nevertheless, its evolutionary relationships were a matter of some controversy (Coomans et al. Reference Coomans, Vinciguerra and Loof1990).
A population of Trachactinolaimus was collected in the course of a nematological survey conducted in northern Iran. Its study revealed that it belonged to an undiscovered species of the genus. Thus, this contribution aims to present its morphological description, provide its molecular (D2-D3 region of 28S rDNA) characterization, discuss its evolutionary relationships in the context of its family Actinolaimidae, and update its taxonomy.
Material and Methods
Sampling, extraction, and morphological identification of nematodes
Several moss samples were collected in the sub-mountain zones of Siahkal forests, located in Gilan province, northern Iran. Moss-dwelling nematodes were extracted using the tray method (Whitehead & Hemming Reference Whitehead and Hemning1965), handpicked under a stereomicroscope, killed by adding hot FPG (4:1:1, formaldehyde: propionic acid: glycerin) solution, transferred to anhydrous glycerine according to De Grisse (Reference De Grisse1969), and mounted on permanent glass slides to be observed under light microscopy (LM). Then, nematodes were measured and photographed using an Eclipse 80i microscope (Nikon, Tokyo, Japan) equipped with differential interference contrast optics, a drawing tube (camera lucida), and a DS digital camera. Ink drawings were made from sketches taken with the camera lucida and/or from photomicrographs processed with Adobe Photoshop CS8. For scanning electron microscopy (SEM), specimens preserved in glycerine were selected and prepared for observation with SEM according to Abolafia (Reference Abolafia2015). They were cleaned in distilled water, dehydrated in a graded ethanol-acetone series, critical point dried, coated with gold, and observed with a Zeiss Merlin microscope (5 kV) (Zeiss, Oberkochen, Germany). Morphological comparisons were performed with the descriptions of other characterized species of Trachactinolaimus. Morphometrics include Demanian indices and other measurements and ratios, some of them presented in a separate table; meanwhile, others form part of the literal description of species. All measurements were recorded in μm, except body length in mm.
DNA extraction, PCR, and sequencing
Following morphological confirmation, some fresh individuals of Trachactinolaimus were selected for DNA extraction. DNA was extracted using the modified Chelex method (Rashidifard et al. Reference Rashidifard, Marais, Daneel, Mienie and Fourie2019). Each nematode was transferred to an Eppendorf tube containing 20 μl of nuclease-free water, 25 μl Chelex (5%, w/v), and 5 μl of proteinase K (20 mg/ml). The microtubes were incubated at 56°C for 2 h, then at 95°C for 10 min, and the obtained solutions were use as DNA template. Five μl of each extracted DNA was added to the polymerase chain reaction (PCR) mixture in a 0.2 ml Eppendorf tube containing 15 μl 2X Master mix (Ampliqon, Odense, Denmark), 1 μl of each primer (10 pmol/μl), and 8 μl ddH2O, to a final volume of 30 μl. The D2-D3 region of 28S rDNA (LSU) was amplified using forward D2A (5’–ACAAGTACCGTGAGGGAAAGTTG–3’) and reverse D3B (5’–TCGGAAGGAACCAGCTACTA–3’) primers (Nunn Reference Nunn1992; De Ley et al. Reference De Ley, Felix, Frisse, Nadler, Sternberg and Thomas1999). PCR reactions were carried out in a DNA thermal cycler (Hybaid, Ashford, Middlesex, UK). The PCR cycle conditions were as follows: initial denaturation cycle at 94°C for 15 min., followed by 35 cycles of denaturation at 94°C for 45 sec; annealing cycle at 56°C for 45 sec; extension cycle at 72°C for 1 min, and finally elongation cycle at 72°C for 5 min. After DNA amplification, the quality of PCR was checked by electrophoresis of 4 μl of the PCR reactions in 1% agarose gel containing SYBR Green I. Products were visualised and photographed under ultraviolet light. The length and concentration of each PCR product were measured by comparison with a low DNA mass ladder (Invitrogen, Carlsbad, CA). The PCR products were purified and sequenced directly for both strands using the same primers with an ABI 3730XL sequencer (Bioneer, Seoul, South Korea). The newly obtained sequences of the D2-D3 region of 28S rDNA were submitted to the GenBank database under accession number PP187312.
Phylogenetic analysis
For phylogenetic relationships, analysis was based on 28S rDNA. The newly obtained sequence was manually edited using Chromas 2.6.6 (Technelysium, Queensland, Australia) and aligned with other 28S rDNA sequences available in GenBank using the ClustalW alignment tool implemented in MEGA7 (Kumar et al. Reference Kumar, Stecher and Tamura2016). Poorly aligned regions at extremes were removed from the alignments using MEGA7. The best-fit model of nucleotide substitution used for the phylogenetic analysis was statistically selected using jModelTest 2.1.10 (Darriba et al. Reference Darriba, Taboada, Doallo and Posada2012). The phylogenetic tree was generated with the Bayesian inference method using MrBayes 3.2.6 (Ronquist et al. Reference Ronquist, Teslenko, van der Mark, Ayres, Darling, Höhna, Larget, Liu, Suchard and Huelsenbeck2012). Two mononchid and five nygolaimid sequences were chosen as outgroups. The analysis under the generalized time reversible and invariant sites and gamma distribution (GTR + I + G) model was initiated with a random starting tree and run with Markov Chain Monte Carlo (Larget & Simon, Reference Larget and Simon1999) simulations for 1 × 106 generations. A total of 25% of samples were discarded as burn-in. The tree was visualized and saved with FigTree 1.4.4 (Rambaut Reference Rambaut2018).
Results
Trachactinolaimus persicus sp. n. (Figures 1–4, morphometrics in Table 1).
Trachactinolaimus persicus sp. n. from Iran (drawings) (a) Female, entire; (b) Male, entire; (c, d) Anterior body region, lateral median view; (e) Anterior body region, lateral submedian view; (f) Vagina; (g) Anterior body region, lateral surface view; (h) Pharyngo-intestinal junction; (i) Neck region; (j) Female, posterior genital branch; (k) Female, posterior body region; (l) Spicule; (m) Male, posterior body region; (n) Ventromedian supplements, in part; (o) Lateral guiding piece. Scale bars: a, b = 200 μm; c, d, h, l = 10 μm; e–g, o = 5 μm; i = 100 μm; j, k, m = 50 μm; n = 20 μm.

Trachactinolaimus persicus sp. n. (female). (a) Entire; (b–d) Anterior body region, lateral median view; (e) Neck region; (f) Posterior genital branch; (g) Posterior body region; (h) Pharyngeal enlargement; (i) Pharyngo-intestinal junction; (j, k) Vagina. Scale bars: a = 200 μm; b–d, h, i = 10 μm; e = 100 μm; f, g = 50 μm; j, k = 5 μm.

Trachactinolaimus persicus sp. n. (male). (a) Entire; (b) Posterior body region; (c) Anterior body region, lateral median view; (d) Ventromedian supplements, in part; (e) Anterior body region, lateral surface view; (f) Spicule; (g) Anterior part of caudal region; (h) Lateral guiding piece. Scale bars: a = 200 μm; b = 50 μm; c, e, h = 5 μm; d, g = 20 μm; f = 10 μm.

Trachactinolaimus persicus sp. n. (SEM). (a) Male, entire; (b) Lip region, in face view; (c) Lip region, sublateral view; (d) Cloacal aperture, ventral view; (e) Vulva, ventral view; (f) Female, caudal region; (g) Male, caudal region; (h) Ventromedian supplements, lateral view; (i) Ventromedian supplements, ventral view. Scale bars: a = 200 μm; b–d = 5 μm; e = 2 μm; f, h, i = 20 μm; g = 50 μm.

Main morphometrics of Trachactinolaimus persicus sp. n. from Iran. Measurements in μm except L in mm, and in the form: average ± SD (range)

Material examined: Fifteen females and nine males from one location, in excellent state of preservation.
Adult: Medium-sized nematodes, 1.95–2.44 mm long. Body cylindrical, appreciably tapering towards the anterior end and much more strongly towards the posterior end as the tail is long and filiform in both sexes. Upon fixation, habitus curved ventrad, C-shaped in females, G-shaped in males. Cuticle smooth, 2–2.5 μm thick at anterior region, 4–5 μm in mid-body and 4.5–6 μm on tail, two-layered, with a thin outer layer and a thicker inner layer. Lip region slightly expanded and hardly offset by a weak depression, 2.0–2.5 times as wide as high and ca one-third (28–36%) of body diameter at neck base, with amalgamated lips and low papillae, anterior margin visibly sunken, in lateral view appearing as a 11–12 μm wide depression 2.5–3.5 μm deep, bearing an elevated perioral part that occupies about one-half of depression width; SEM observations (Figure 4b, c): oral field wide, delimited by a thick, ring-like structure, offset from the adjoining part of lip region, with inner labial papillae close to it but out the field, oral aperture surrounded by a circular projection bearing abundant radial prongs, labial and cephalic papillae small and weakly prominent on lip region surface, amphid aperture a comparatively wide transverse slit. Cheilostom typical actinolaimid, 17–20 μm long (from fixed guiding ring to anterior end), consisting of a labial chamber 9–10 μm wide bearing four onchia and scattered denticles, and postlabial portion somewhat narrower than labial chamber and with thick walls. Odontostyle strong, 8.2–10.9 times as long as wide, longer (1.3–1.4 times) than lip region diameter, and 1.06–1.31% of body length, with large aperture occupying 10–11 μm or two-fifths (39–42%) of total length. Guiding ring double, distinct, especially the fix ring. Odontophore rod-like, lacking any differentiation, slightly shorter (0.8–0.9 times) than odontostyle. Pharynx entirely muscular, very gradually enlarging into the basal expansion that is 7.1–10.1 times as long as wide, 4.2–5.9 times as long as body diameter at neck base, and occupies one-half (49–52%) of the total neck length; gland nuclei located as follows: DO = 49–52, DN = 52–55, S1N1 = 75–77, S1N2 = 76–78, S2N = 85–88. Nerve ring located at 155–177 μm or 27–30% of the total neck length from the anterior end. Pharyngo-intestinal junction consisting of a 23–30 x 13–17 μm conoid cardia enveloped by intestinal tissue, a ring-like structure surrounding the junction between pharyngeal base and cardia, and a dorsal lobe. Tail long and filiform, often almost straight, first appreciably tapering, then much more gradually until the very finely rounded tip, its inner core extending to 55–71% of tail length, thus with a appreciably hyaline portion; caudal pores two pairs, one lateral, another subdorsal, situated ca one body diameter behind the anal/cloacal aperture.
Female: Genital system diovarian, with equally and well-developed genital branches that occupies 282–400 μm or 13–17% of body length. Ovaries reflexed, variably sized, 89–136 μm long, often not surpassing the sphincter level, with oocytes first in several rows and then in a single row. Oviduct subterminally joining the ovary, 70–164 μm long or 1.6–2.3 times the body diameter, consisting of a long distal part made of prismatic cells and an appreciable proximal pars dilatata with wide lumen and usually bearing sperm cells inside. A shallow sphincter separates oviduct and uterus. Uterus a tube-like structure 160–243 μm long or 2.6–3.9 times the body diameter, with two regions, almost equally long, the proximal one barely wider and ampler lumen inside, the distal one with narrower lumen. Vagina extending inwards 24–31 μm to reach up to one-half (40–50%) of body diameter: pars proximalis 14–20 x 15–19 μm, with almost straight or slightly sigmoid walls surrounded by weak circular muscles; pars refringens with (in lateral view) two close together trapezoidal or drop-shaped sclerotized pieces 6–7 x 3.5–4 μm and with a combined width of 12–15 μm; pars distalis 4–7 μm long. Vulva an almost pore-like opening preceded of a weak depression. Prerectum 3.8–5.2, rectum 1.4–1.6 anal body diameters long.
Male: Genital system diorchic, with opposite testes. Prerectum 5.4–6.3, cloaca 1.7–1.9 times as long as body diameter at level of cloacal aperture. Cloacal aperture a transverse arched opening. In addition to the ad-cloacal pair, located at 7–10 μm from the cloacal aperture, there is a series of 12–14, almost contiguous, 4–13 μm apart, ventromedian supplements located on a low ventral longitudinal ridge that is separated from the adjoining body by two parallel longitudinal grooves, with the most posterior supplement situated at 75–86 μm from the ad-cloacal part, thus with an appreciable hiatus. Spicules dorylaimid, 5.2–6.0 times as long as wide and 1.9–2.1 times longer than body diameter at cloacal aperture: head 12–13 μm long or 26–30% of spicule length, 1.7–2.1 times as long as wide, with its dorsal side conspicuously longer than the ventral one; median piece occupying less than one-fourth (21–24%) of spicule diameter; posterior tip 2–2.5 μm wide; curvature 130–136º. Lateral guiding pieces 17–23 μm long, 4.9–6.7 times as long as wide, gradually tapering until a rather narrow posterior tip.
Molecular characterization
One sequence of the D2-D3 region of 28S rDNA with 739 bp was obtained for Trachactinolaimus persicus sp. n. The sequence was analysed and compared with three sequences of Trachactinolaimus nanjingensis (ON054911, ON054912, ON054913) and other rDNA sequences of dorylaims available in the GenBank database. In a segment in common with 708 bp, both Trachactinolaimus species show 38 bp differences (substitution, insertions, or deletions) or 95% similarity.
Diagnosis
The new species is characterized by its 1.95–2.44 mm long body, lip region weakly offset by depression and 18–20 μm wide, odontostyle 25–27 μm long with aperture occupying ca two-fifths of its length, double guiding ring, neck 540–636 μm long, pharyngeal expansion occupying ca one-half of the total neck length, female genital system diovarian with bipartite uterus 2.6–3.9 body diameters long, vulva (V = 49–53) a transverse slit, tail long and filiform in both sexes (174–223 μm, c = 10.0–13.4, c’ = 5.9–7.0 in females, 165–196 μm, c = 10.7–13.8, c’ = 4.6–5.8 in males), spicules 68–75 μm long, and 12–14 almost contiguous ventromedian supplements with hiatus.
Separation from its relatives
Morphometrically, the new species is similar to T. dominicus, T. montanus, and T. radulatus, three poorly characterized species (see also general discussion). It differs from T. dominicus, a Neotropical (Dominica) endemism (Hunt Reference Hunt1978), in its smaller general size (body length 1.95–2.44 vs. 2.31–2.64 mm, respectively), comparatively less slender body (a = 32–44 vs. a = 48–56), relatively shorter tail (c’ = 5.9–7.0 vs. 9.6–12.7 in females, 4.6–5.8 vs. 6.2–8.0 in males), longer spicules (68–75 vs. 58 μm), and higher number of ventromedian supplements (12–14 vs. 9). Besides, Coomans et al. (Reference Coomans, Vinciguerra and Loof1990), who studied type specimens, illustrated the lip region of T. dominicus lacking an elevated perioral region at the centre of labial depression (see their Figure 4C), a relevant feature that might represent an additional significant difference between both species.
It differs from T. montanus, at present an European (Georgian) endemism (Eliava & Jgenti Reference Eliava and Jgenti2006), in its longer odontostyle (25–27 vs. 23–24 μm), much shorter odontophore (0.8–0.9 vs. 1.5 times the odontostyle), absence of a uterine Z-like differentiation (vs. Z-like differentiation elongated), relatively shorter female tail (c = 10.0–13.4 vs. 9.8–10.3), and larger spicules (68–75 vs. 61–65 μm). The original description of T. montanus is a bit laconic, and the corresponding illustrations lack details for comparative purposes, but available data about this species support its separation from the new one herein described.
It differs from T. radulatus, an Afrotropical (Angola) endemism, in its comparatively narrower lip region (18–20 vs. 22–24 μm, calculated from literal description), longer spicules (68–75 vs. 56–61 μm) and lower number of ventromedian supplements (12–14 vs. 14–17). Besides, Coomans et al. (Reference Coomans, Vinciguerra and Loof1990), who studied type material, described a well-developed Z-like differentiation at both uteri (see their Figure 4G–H), indeed a significant morphological difference between both species.
Type locality and habitat
Northern Iran, Gilan Province, Siyahkal County, Gilbam Village (GPS coordinates: 37° 4’ 26’’ N, 49° 46’ 33’’ E; altitude: 84 m above sea level), where the new species was recovered from mosses growing on forest trees, collected on 20 October 2022.
Type material
Female holotype, five female paratypes, and five male paratypes have been deposited at the Nematode Collection of the Departamento de Biología Animal, Biología Vegetal y Ecología, Universidad de Jaén, Spain. Seven female paratypes and three male paratypes have been deposited at the Nematode Collection of the Faculty of Agriculture, University of Zanjan, Zanjan, Iran.
Etymology
The species epithet refers to ‘Persia’, the Latin former name of Iran.
Discussion
Taxonomy and evolutionary relationships of Trachactinolaimus
Historical outline: Thorne (Reference Thorne1967) proposed the family Trachypleurosidae (in Actinolaimoidea) to include the genera Trachypleurosum Andrássy, Reference Andrássy1959 (= Trachypleura Thorne, Reference Thorne1939, nec Jackel (Reference Jaekel1900)) and Actinolaimoides Meyl, Reference Meyl1957 and distinguished them from other actinolaims by the long and filiform tail of both sexes (vs. rounded-tailed males in other genera). Andrássy (Reference Andrássy1976) also included Trachactinolaimus in Trachypleurosidae, whereas Siddiqi (Reference Siddiqi1982) stated that Actinolaimoides was not a true actinolaimid taxon but a member of Nordiidae. Several authors (Baqri et al. 1975; Vinciguerra Reference Vinciguerra1988; Coomans Reference Coomans, Vinciguerra and Loof1990) recommend re-lowering the actinolaims to family rank, and, consequently, their families to subfamilies. In this system, Vinciguerra (Reference Vinciguerra1988), who carried out a fine cladistic analysis of actinolaims, classified Trachypleurosum as the only genus of Trachypleurosinae and characterised this subfamily by lacking onchia. Moreover, Trachactinolaimus was considered to be a member of Actinolaiminae Thorne, Reference Thorne1939. Coomans et al. (Reference Coomans, Vinciguerra and Loof1990), who studied type material of Trachypleurosum and Trachactinolaimus, questioned the evolutionary relationships of both genera as they confirmed the presence of onchia in Trachypleurosum and regarded the long tail in both sexes, a remarkable trait shared by the two genera, as a plesiomorphic condition. Jairajpuri and Ahmad (Reference Jairajpuri and Ahmad1992; see also Khan & Jairajpuri Reference Khan and Jairajpuri1994) proposed the subfamily Paractinolaiminae in Actinolaimidae to group five genera, including Trachactinolaimus and the new genus Dominiactinolaimus, characterised by having cheilostomal denticles among other distinctive features, whereas Trachyplerosum was mantained as the only member of the family Trachypleurosidae. Vinciguerra (Reference Vinciguerra, Eyualem-Abebe, Traunspurger and Andrássy2006) did not recognize any subfamily within Actinolaimidae, and Andrássy (Reference Andrássy2009) classified Trachactinolaimus and Trachypleurosum under Trachypleurosinae and regarded Dominiactinolaimus as identical to and a junior synonym of the latter.
New evidence based on morphological data: As mentioned, one of the most recognizable traits of Trachactinolaimus is its long-tailed males, an unusual feature of actinolaims, only shared with Trachypleurosum. Their long-tailed males easily separate these two genera from the remaining genera of Actinolaimidae (16 of 18 valid, cf. Andrássy Reference Andrássy2009) that display sexual dimorphism in tail shape as all of them have rounded-tailed males. This represents a major morphological difference that was originally used by Thorne (Reference Thorne1967) to create the family Trachypleurosidae and later by Andrássy (Reference Andrássy2009) to keep the subfamily Trachyplerosinae. Nevertheless, and as pointed out by Coomans et al. (Reference Coomans, Vinciguerra and Loof1990), the long and filiform tail, in this case in males, should be interpreted as a primitive (plesiomorphic) condition that does not warrant that Trachactinolaimus and Trachypleurosum form a monophyletic taxon, therefore assuming that reduction of tail length might have occurred more than one time throughout the evolutionary history of actinolaims. In this sense, Coomans et al. (Reference Coomans, Vinciguerra and Loof1990) stated that (p. 153) “Trachactinolaimus is very close to Paractinolaimus, differing from it only in shape of male tail.” This matter is probably one of the reasons why Vinciguerra (Reference Vinciguerra, Eyualem-Abebe, Traunspurger and Andrássy2006) did not recognize any subfamiliar division in Actinolaimidae.
On the other hand, Trachactinolaimus and Trachypleurosum are very similar taxa, differing in the presence vs. absence of cheilostomal denticles, respectively. According to Coomans et al. (Reference Coomans, Vinciguerra and Loof1990), the former is more plesiomorphic as the absence of denticles should be regarded as a derived (apomorphic) condition in actinolaims (cf. Vinciguerra (Reference Vinciguerra1988).
Molecular approach: Molecular analysis, whose results are presented in the tree of Figure 5, shows some relevant findings. First, and in spite of the limited number of available sequences of actinolaimid taxa, the monophyly of Actinolaimidae is confirmed as their sequences form a totally (100%) supported clade. Second, the genus Trachactinolaimus should be regarded as a monophyletic taxon too because its four sequences (of two species) constitute a totally (100%) supported subclade too, separated from the remaining actinolaimid sequences, which seem to be a more heterogeneous group. Third, a close evolutionary relationship between actinolaims and members of the family Dorylaimidae (genera Dorylaimus, Labronema, Nevadanema, and Prodorylaimus) is observable, thus confirming that Dorylaimidae might be the outer sister group of actinolaims (Holterman et al. Reference Holterman, Rybarczyk, Van den Essen, van Megen, Mooyman, Peña-Santiago, Bongers, Bakker and Helder2008; Andrássy Reference Andrássy2009).
Bayesian Inference tree from the newly sequenced Trachactinolaimus persicus sp. n. based on sequences of the 28S rDNA region. Bayesian posterior probabilities (%) are given for each clade. Scale bar shows the number of substitutions per site.

Updated taxonomy of Trachactinolaimus
Diagnosis: Actinolaimidae. Medium- to large-sized nematodes, 1.95– 4.41 mm long. Cuticle dorylaimid. Lip region hardly offset by a shallow depression, with totally fused lips; oral field sunken, delimited by a ring-like margin; oral aperture often protruding, surrounded by a crown-like structure consisting of numerous, contiguous and radial prongs. Amphid fovea cup-like, its aperture occupying ca one-half of lip region diameter. Cheilostom consisting of a wide labial chamber bearing four large onchia and abundant denticles, and a postlabial section with thick walls. Odontostyle strong, with wide aperture. Guiding ring double. Odontophore rod-like, lacking any differentiation. Pharynx entirely muscular, gradually enlarging into the basal expansion that occupies ca one-half of the total neck length. Female genital system diovarian, with uterus including or not a Z-like differentiation, pars refringens vaginae, and longitudinal or pore-like vulva. Tail similar in sexes, long and filiform. Spicules dorylaimid. Ventromedian supplements 12–23 in number, almost contiguous, with large hiatus.
Type species
T. radulatus Andrássy, Reference Andrássy1963
Other species
T. brevicaudatus Wu & Liang, Reference Wu and Liang1999
T. dominicus (Hunt, Reference Hunt1978) Vinciguerra, Reference Vinciguerra1988
= Paractinolaimus dominicus Hunt, Reference Hunt1978
= Dominiactinolaimus dominicus (Hunt, Reference Hunt1978) Jairajpuri & Ahmad, Reference Jairajpuri and Ahmad1992
= Trachypleurosum dominicum (Hunt, Reference Hunt1978) Andrássy, Reference Andrássy2009
T. montanus Eliava & Jgenti, Reference Eliava and Jgenti2006
T. najingensis Zhang, Ji, Guo, Qing & Li, Reference Zhang, Ji, Guo, Qing and Li2023
T. persicus sp. n.
Key to species identification
1– Larger general size, body length 2.64–4.41 mm in females. Male tail appreciably shorter (c = 22–39, c’ = 1.9–3.5) …………………………………………………………………
2– Smaller general size, body length 1.95–2.70 mm in females. Mail tail appreciably longer (c = 7.8–16.6, c’ = 4.0–8.0) …………………………………………………………………… 3
2– Females 4.02–4.41 mm long. Spicules 67–76 μm long. Ventromedian supplements 20–23 in number ……………………………………………………………………………. brevicaudatus
– Females 2.64–3.42 mm long. Spicules 55–64 μm long. Ventromedian supplements 15–19 in number …………………………………………………………………….………… nanjingensis
3– Uterus bearing a Z-like differentiation ……………………………….…………………………. 4
– Uterus lacking a Z-like differentiation ……………………………………….……………………. 5
4 – Odontostyle 23–24 μm long. Shorter female tail (c’ = 4.0–6.5) ……….………. montanus
– Odontostyle 27 μm long. Longer female tail (c’ = 8–9) ………………………… radulatus
5 – Less slender body (a = 32–44). Longer tail (c’ = 9.6–12.7 in females, 6.2–8.0 in males). Spicules 58 μm long. 9 ventromedian supplements ……….……………………. dominicus
– More slender body (a = 48–56). Shorter tail (c’ = 5.9–7.0 in females, 4.6–5.8 in males). Spicules 68–75 μm long. 12–14 ventromedian supplements ……………… persicus sp. n.
Tables 1 & 2 compile the main morphometrics of Trachactinolaimus species.
Main morphometrics (ranges) of species of the genus Trachactinolaimus. Measurements in μm except L in mm

References: 1, Wu and Liang (Reference Wu and Liang1999); 2, Hunt (Reference Hunt1978); 3, Eliava and Jgenti (Reference Eliava and Jgenti2006); 4, Zhang et al. (Reference Zhang, Ji, Guo, Qing and Li2023); 5, Andrássy (Reference Andrássy1963).
* Calculated from description and/or other morphometrics.
1 Specimens from two or more locations.
Other concluding remarks
Actinolaims are an easily recognizable dorylaimid taxon characterised by the presence of four large teeth (onchia) at their heavily sclerotized cheilostom, which represents a very remarkable autapomorphy of the group. Molecular analysis herein presented results in the confirmation than they form part of a robustly supported clade, then confirming their monophyly, with Dorylaimidae as their sister (and more plesiomorphic) taxon.
Available information also suggests (supports) the idea that Trachactinolaimus is a natural (monophyletic) genus, certainly primitive within actinolaims when its tail shape (long and filiform in both sexes, a plesiomorphic condition) is compared to that observed in other genera (rounded-tailed males, an apomorphic state) with the exception of Trachypleurosum. Thus, it cannot be discarded that Trachactinolaimus forms part (together with Trachyplerosum, another member of Trachypleurosinae) of the sister group of the remaining actinolaims, a hypothesis that deserves further study (cf. Coomans et al. Reference Coomans, Vinciguerra and Loof1990).
The two Trachactinolaimus species (only) known to occur in China, namely T. brevicaudatus and T. nanjingensis, differ from the remaining components of the genus in several features. First, their general size is appreciably larger (body length 2.50–4.41 vs. 1.95–2.70 mm long). Second, and more interestingly, male tail is tapering less regularly than in females and even the males of other species (first abruptly and then very gradually vs. gradually throughout its length), and its length is significantly shorter than that of their respective females (vs. both females and males with comparable length in other species). Thus, these two species might form part of a geographical subclade of the genus.
Andrássy (Reference Andrássy2009) regarded Dominiactinolaimus as a junior synonym of Trachypleurosum. Nevertheless, it was probably a mistake by the author as, having denticles in its cheilostom (Hunt Reference Hunt1978; Coomans et al. Reference Coomans, Vinciguerra and Loof1990; Jairajpuri & Ahmad Reference Jairajpuri and Ahmad1992), it is identical to Trachactinolaimus, not to Trachypleurosum.
Acknowledgements
The Spanish authors thank the staff (Amparo Martínez-Morales) and equipment of “Centro de Instrumentación Científico-Técnica (CICT)”, University of Jaén, for assistance in obtaining SEM pictures of the new species herein described.
Financial support
Funding was provided by the University of Jaén, Spain, through the research program ‘PAIUJA 2023/2024: EI_RNM2_2023’.
Competing interest
None.
Ethical standard
The authors assert that all procedures contributing to this work comply with the ethical standards of the relevant national and institutional guides on the care and use of laboratory animals.