Introduction
Human cercarial dermatitis (HCD), or swimmer's itch, is a nuisance disease in those who have contact with certain freshwater habitats. Within the British Isles, it remains unclear whether the avian schistosome Bilharziella polonica (Trematoda: Schistosomatidae) is a prominent cause (Fraser et al., Reference Fraser, Allan, Roworth, Smith and Holme2009; Morley, Reference Morley2009). First detected in the United Kingdom as emergent cercariae from the great ram's horn snail, Planorbarius corneus, in Roath Park Lake, Cardiff by Iles (Reference Iles1959), its last formal report was by Khan (Reference Khan1961), again as emergent cercariae from P. corneus from Lake Meadows Park, Billericay. Other avian schistosomatids, particularly those within the genus Trichobilharzia, are assumed to be primarily responsible for HCD in the United Kingdom (Lawton et al., Reference Lawton, Lim, Dukes, Cook, Walker and Kirk2014), across Europe (Soldánová et al., Reference Soldánová, Selbach, Kalbe, Kostadinova and Sures2013; Żbikowska & Marszewska, Reference Żbikowska and Marszewska2018; Juhász et al., Reference Juhász, Majoros and Cech2022) and elsewhere (Loker et al., Reference Loker, DeJong and Brant2022), overshadowing any B. polonica incrimination(s). From a phylogenetic perspective, B. polonica is basal to a diverse clade of avian schistosomatids that includes the species-rich genus Trichobilharzia; the latter genus continues to expand upon increased populational sampling as novel genetic variants are encountered (Loker et al., Reference Loker, DeJong and Brant2022). Of note, Prüter et al. (Reference Prüter, Sitko and Krone2017) found adult worms of B. polonica within the central nervous system of naturally infected mallards, raising a first concern of its underappreciated neurotropic behaviour.
Knowsley Safari (KS), Prescot is a 550-acre reserve with both drive-through and walk-through visitor areas, including a small lake occasionally used for recreational boating. Home to over 700 exotic animals, KS receives approximately 600,000 visitors a year (see fig. 1). KS visitors are also encouraged to engage with native species through activities such as mini-beast hunts and pond dipping activities as organized by KS’ research and conservation and education teams, as well as enjoy rowing boat activities within their small recreational lake. In light of growing concerns about HCD in the United Kingdom, such water-contact activities might not be so benign (Fraser et al., Reference Fraser, Allan, Roworth, Smith and Holme2009; Lawton et al., Reference Lawton, Lim, Dukes, Cook, Walker and Kirk2014). During July 2021, as part of ongoing surveillance for snail-borne diseases within KS, a collection was made of various freshwater snails at known water contact points, some of which were within public access areas. In the laboratory, emergent cercariae were studied from a selection of inspected snails. We draw attention upon our observations of B. polonica and Trichobilharzia spp. and its context of future risk management of HCD in KS.
The 15 sample sites, red circles, for the malacological survey performed at Knowsley Safari. The sites were selected upon discussions with the chief veterinarian and enclosure staff for water bodies that had known animal or human water contact. Cercariae of Bilharziella polonica were found at site 8 (denoted by *) within a public area. Cercariae of Trichobilharzia spp. at sites 1 and 3 (denoted by +) within a non-public enclosure. Sites 2 and 14 (denoted by X) contain Galba truncatula, the keystone intermediate snail host for Fasciola hepatica, within a non-public enclosure.

Material and methods
Collection and morphological description of snails and emergent trematode cercariae
Over three consecutive days in July 2021, a total 173 Planorbidae and 218 Lymnaeidae snails were collected from 15 sample sites at KS, north-west England (see fig. 1).
The sampling sites were purposefully chosen, upon discussions with KS veterinarians, to be representative of both public access areas and restricted staff access areas in specific animal enclosures. Snails were collected by hand and metal scoops, typically with 15–20 min of active searching by four people. Collected snails were identified through shell morphology according to the taxonomic keys of Rowson et al. (Reference Rowson, Powell, Willing, Dobson and Shaw2021) which adopt the now favoured multi-generic and classification revision of United Kingdom lymnaeids, for example, Ampullacaena balthica.
Once in the laboratory, snails were grouped by species for an initial inspection for shedding cercariae in plastic beakers containing bottled drinking water with exposure to bright natural light. If cercariae were seen, snails were then separated individually into 6-well tissue culture plates and the next day were exposed to natural light between 10.00 and 16.00 to encourage the cercarial emergence. Cercariae were harvested by pipette, then observed under a light microscope, with either Lugol's iodine or Fuchsin staining. Emergent cercariae were identified, as far as possible to species-level, using keys from Combes et al. (Reference Combes, Albaret and Arvy1980), Frandsen & Christensen (Reference Frandsen and Christensen1984) and Podhorský et al. (Reference Podhorský, Huůzová, Mikeš and Horák2009).
A selection of emergent cercariae were individually placed on Whatman FTA indicator cards for short-term storage (Whatman plc, Maidstone, UK) preceding total DNA extraction (see below). Collected snails were then crushed between two glass slides under a dissecting microscope to visualize any trematode sporocysts and rediae (parthenites) to estimate pre-patent prevalence of infection(s), although their species identity was presumed upon morphology of emergent cercariae.
Molecular identification of emergent cercariae
Genomic DNA was extracted from FTA punches using published protocols (Gower et al., Reference Gower, Shrivastava, Lamberton, Rollinson, Webster, Emery, Kabatereine and Webster2007), containing morphologically identified B. polonica cercariae from P. corneus and Trichobilharzia spp. cercariae from Ampullacaena balthica. The 340 base pair ASMIT region of the mitochondrial cytochrome oxidase 1 gene (cox1) was amplified with primers ASMIT 1 (5′ TTTTTTGGGCATCCTGAGGTTTAT 3′) and ASMIT 2 (5′ TAATGCATMGGAAAAAAACA3′) (see Bowles et al., Reference Bowles, Blair and McManus1992). Reactions were in 25 μL comprising 3 μl of extracted genomic DNA (~100 ng), 1.5 μl of MyTaq red mix (Meridian Biosciences), 1 μl of each primer (5 pmols/μl) and 7.5 μl of double-distilled water. The thermal profile consisted of an initial denaturation step of 95°C for 1 min, followed by 40 cycles of 95°C for 15 s; 45°C for 30 s; and 72°C for 30 s. The polymerase chain reaction (PCR) was then finished with a terminal extension at 72°C for 2 min, then reactions stored at 4°C before electrophoresis. To check amplifications, products were separated in 2.0% agarose gels in Tris-Acetate-EDTA buffer gel, stained with SYBR™ safe. If suitable, reaction products were purified with Exo-SAP-IT (Applied Biosystems), and sent for Sanger sequencing at Source BioScience Sequencing, UK, using both forward and reverse ASMIT primers (Stothard et al., Reference Stothard, Webster, Weber, Nyakaana, Webster, Kazibwe and Rollinson2009).
Analysis of cox1 sequences
Retrieved partial cox1 sequences were assembled using MEGA 11 (Kumar et al., Reference Kumar, Stecher, Li, Knyaz and Tamura2018), with base-calls corrected manually before submission to GenBank (Accession Numbers: ON987329-ON987334). A selection of comparable cox1 sequences were downloaded from GenBank. Nucleotide sequences were aligned with the software CLUSTAL W (Thompson et al. Reference Thompson, Higgins and Gibson1994). Maximum likelihood (ML) was performed – the analysis involved 36 nucleotide sequences. There was a total of 357 positions in the final dataset. The dataset was tested using MEGA 11 for the nucleotide substitution model of best fit – the Tamura–Nei substitution model was chosen by the Akaike information criterion. Bootstrap values based on 1000 re-sampled datasets were generated. The phylogenetic tree presented visualized using the tree explorer of MEGA 11 under the TN93 + G + I model to give an outline appraisal of schistosomatid species identity and diversity. Heterobilharzia americana (MW425690) was chosen as an outgroup.
Chronobiology, swimming behaviour and vertical swimming rate (VSR) of cercariae
Planorbid snails found to be shedding cercariae were individually monitored further over a 24-h period on three separate days. Briefly, every two hours the infected snail was moved into a new well within the 6-well tissue culture tray. Water within each well was later harvested by syringe then filtered across a 10 μm nylon mesh filter and stained with Lugol's iodine to enumerate cercariae under a dissection microscope (×10).
The VSR for B. polonica cercariae was estimated following Morley (Reference Morley2020) whereby the phototaxis of swimming cercariae towards a light source is measured. A 30 ml clear glass specimen tube was surrounded by a dark card, apart from a small longitudinal viewing port slit. This slit enabled visualization of a white 4 mm card. Light was firstly shone from above or below the tube using a handheld torch for 30 s, thereby aggregating cercariae either at the top or bottom of the water column. After this the light was moved to the opposing side, causing positive phototaxis. Using a hand-lens, individual cercariae were measured for the time taken to cross the 4 mm white card, permitting a VSR in mms−1. A box plot was presented of VSR in either descending or ascending swimming directions.
Results
Encountered snails with emergent trematode cercariae
Within KS, 15 aquatic locations were purposely selected and then examined in July 2021 (see fig. 1). Freshwater snails were found at nine locations (present at sites: 1, 2, 3, 4, 7, 8, 9, 13 and 14) with six locations devoid of snails (absent at sites: 5, 6, 10, 11, 12 and 15). Site 8 contained greatest snail species diversity. A total 391 freshwater snails were collected representative of planorbids (n = 173) and lymnaeids (n = 218) (see tables 1 and 2).
List of planorbid snails with emergent cercariae within Knowsley Safari.

a estimation of infections takes into account data from snail crushing, though it is an imprecise identification method.
List of lymnaeid snails with emergent cercariae within Knowsley Safari.

a estimation of infections takes into account data from snail crushing, though it is an imprecise identification method.
Four planorbid species, Anisus vortex (n = 113), Planorbarius corneus (n = 35), Planorbis planorbis (n = 23), Gyraulus albus (n = 2), and two lymnaeid species, Ampullaceana balthica (n = 202) and Galba truncatula (n = 16), were encountered. Across the 15 sites sampled, P. corneus and A. balthica were found at two and five sites, respectively, both in public access and in restricted access animal enclosure areas (tables 1 and 2).
Of the 173 planorbids inspected, 46 (26%) were infected with a larval trematode stage. Even though P. corneus was collected from two almost adjacent sites, infected snails were encountered in one location alone, site 8. This site presented with the widest diversity of snail and cercariae of at least three different species, noting echinostomes in both planorbids and lymnaeids (tables 1 and 2). Of the 218 lymnaeids inspected, 87 (40%) were infected with a larval trematode stage (table 2). Only one P. corneus was found to be actively shedding B. polonica (fig. 2.), which also enabled a comparative chronobiological investigation against Cotylurus sp., as being shed from another P. corneus. Several A. balthica were noted to shed Trichobilharzia spp. cercariae at sites 1 and 3.
Cercariae of Bilharziella polonica
stained with Lugol’s iodine. Scale bars = 50 μm.

Identification of emergent cercariae with cox1 sequences
A total of six partial cox1 were obtained for cercariae of B. polonica (BP1-3) and Trichobilharzia spp. (TB1-3), with a cursory ML analysis shown in fig. 3. While there was minimal sequence variation within B. polonica samples, the Trichobilharzia clearly represented two taxa upon their phylogenetic positions, TB1 viz. Trichobilharzia anseri and TB 2 and 3, an unnamed lineage with some affiliation with Trichobilharzia longicauda and Tricholbilharzia physella and Allobilharzia visceralis.
Maximum likelihood tree based on partial cytochrome oxidase 1 gene sequences of Bilharziella (BP1–3) and Trichobilharzia (TB1–3) cercariae samples from the present study in relation to other schistostomatid sequences deposited in GenBank. Bootstrap values are given at the nodes. Samples from the present study are in boldface type. The scale bar indicates the expected number of substitutions per site.

Chronobiology and VSR of trematode cercariae
The chronobiology of shedding cercariae from P. corneus was monitored over 24 h on three separate days taking advantage of two shedding snails with different emergent cercariae. The cercariae of B. polonica exhibited a rising trend from late afternoon through to evening, peaking between 18:00 and 22:00. By contrast, Cotylurus sp. cercariae exhibited an earlier afternoon rise around 16:00, with numbers also consistently higher during afternoons. In all, the average number of B. polonica cercariae that were shed was 1142 cercariae per day as compared with an average of 872 cercariae for Cotylurus sp. The phototaxis response of B. polonica was manipulated to determine the VSR in both ascending or descending orientations, with a significantly faster downwards than upwards trending velocity (t-test, t = −5.05, df = 29.80, P = 0.000023) (see fig. 5).
Discussion
Collecting freshwater snails with inspection for emergent cercariae provides an effective first way to assess and alert for snail-borne trematodiases. For example, increased surveillance for HCD is sensible owing to its putative re-emergence due to ongoing climate change (Horák & Kolářová, Reference Horák and Kolářová2011; Horák et al., Reference Horák, Mikeš, Lichtenbergová, Skála, Soldánová and Brant2015; Lashaki et al., Reference Lashaki, Teshnizi, Gholami, Fakhar, Brant and Dodangeh2020). While avian schistosomes have no doubt been present across the British Isles for decades (Morley, Reference Morley2009), it is only recently that HCD has been flagged as of sporadic medical concern in the United Kingdom (Fraser et al., Reference Fraser, Allan, Roworth, Smith and Holme2009; Lawton et al., Reference Lawton, Lim, Dukes, Cook, Walker and Kirk2014). In KS while there have been no formal reports of HCD, either in KS visitors or in staff, our snail–trematode surveys have revealed an underlying new risk to consider upon encounter of these three avian schistosome species.
Even though eDNA assays are having some application in monitoring HCD in environmental water bodies (Jothikumar et al., Reference Jothikumar, Mull, Brant, Loker, Collinson, Secor and Hill2015), such real-time PCR assays are currently only Trichobilharzia-specific. Less common avian-schistosomes, such as B. polonica, are overlooked as existing primers’ combinations do not target its eDNA. By contrast, our combination of more traditional snail and cercarial surveillance, as augmented by cox1 barcoding, has revealed the unexpected presence of this rather rare avian-schistosome. Its last reported presence in the United Kingdom was over 50 years ago, some 175 km further south, despite the more recent presence and study of avian schistosomatids elsewhere (Brant & Loker, Reference Brant and Loker2009; Horák & Kolářová, Reference Horák and Kolářová2011). Indeed, relatively little is known about this trematode and its natural history (Loker et al., Reference Loker, DeJong and Brant2022). For example, a recent molecular epidemiological study from one of the major recreational lakes in Poland has suggested the presence of a cryptic Bilharziella sister species, which is not surprising given the general lack of targeted surveillance for this trematode (Stanicka et al., Reference Stanicka, Migdalski, Zając, Cichy, Lachowska-Cierlik and Żbikowska2021). Our report here hopes to stimulate some further interest and better awareness in the United Kingdom about this rather rare trematode.
In the context of KS, site 8, a small artificial plastic lined pond, is directly beneath the earthen dam of the recreational boating lake. It is sometimes used in pond dipping from the wooden walkway. Of note here, the recreational boating pond is home to several species of duck and goose. While P. corneus was not found in the recreational boating lake at the time of survey, this snail appears presently very restricted within KS to only two adjacent sites, each probably connected during flooding. As a likely consequence, B. polonica is also geographically very focalized, even down to a single snail, though such an infected snail can release copious numbers of highly motile cercariae within its micro-habitat (see figs 4 and 5).
Chronobiology of daily emergence of Bilharziella polonica (A) and Cotylurus sp. (B) cercariae during replicates on three consecutive days from two Planorbarius corneuscarrying separate infections. A greater number of B. polonica were observed during the period of observation with greatest emergence toward early evening.

Comparison of the vertical swimming rate of Bilharziella polonica cercariae when swimming either upwards or downwards orientations. There was a statistically significant effect between directions, likely representing a further impact of perhaps gravity or a positive geotaxis.

It is outside the scope of this paper to speculate upon the clinical risk that B. polonica might cause, particularly given its recently appreciated neurotropic behaviour (Prüter et al., Reference Prüter, Sitko and Krone2017). A sensible precautionary measure or an appropriate risk management strategy against HCD would be for adults and children to wear protective gloves when pond dipping. This should be alongside targeted introduction of basic educational information to raise awareness of HCD both in visitors and staff. Similarly, any immediate post-exposure application of ethanol-based disinfectant hand gels, now commonly available since the onset of the COVID-19 pandemic, to affected skin should be an efficacious knock-down of any avian schistosome cercariae adhered.
As mentioned, avian-schistosomes of the genus Trichobilharzia are more often implicated with HCD in freshwater (Loker et al., Reference Loker, DeJong and Brant2022). Across the United Kingdom, precise incrimination of which species of Trichobilharzia is/are culpable is open to conjecture. For example, Trichobilharzia franki was implicated by Lawton et al. (Reference Lawton, Lim, Dukes, Cook, Walker and Kirk2014) upon their inspection of Tundry Pond, Hampshire, but this species was not encountered here. Our cox1 analysis of emergent cercariae from A. balthica has now implicated two other taxa, T. anseri, a first report in the United Kingdom, and a novel genetic lineage with some affiliation with T. longicauda, alongside T. physellae and Allobilharzia visceralis (see fig. 3).
As proposed by Loker et al. (Reference Loker, DeJong and Brant2022), with further genetic scrutiny of emergent cercariae additional novel cox1 lineages of Trichobilharzia will appear. This has also recently occurred with increased B. polonica cox1 lineage sampling (Stanicka et al., Reference Stanicka, Migdalski, Zając, Cichy, Lachowska-Cierlik and Żbikowska2021). Two decades ago, Kolárová et al. (Reference Kolárová, Skirnisson and Horák1999) described T. anseri upon morphological features of cercariae which was then linked with an official description of T. anseri (Jouet et al., Reference Jouet, Kolářová, Patrelle, Ferté and Skírnisson2015). Since then, this species has only been noted in Denmark in 2021 (Al-Jubury et al., Reference Al-Jubury, Duan, Kania, Tracz, Bygum, Jørgensen, Horák and Buchmann2021) and our report here is a first report of T. anseri in the United Kingdom. Similarly, our TB2/3 lineage which has some affiliation with T. longicauda, is a tentative first United Kingdom report as we await later inspection of adult worms, or eggs thereof, obtained from local birds, for example, ducks and geese. These birds are sometimes available for dissection upon natural or accidental mortalities within KS.
Conclusion
Our snail survey of 15 freshwater habitats has set a contemporary biological baseline for future surveillance of HCD within KS alongside an outline risk appraisal. In total, three avian-schistosome species, as emergent cercariae from two freshwater snail species, were identified within KS park boundaries.
Supplementary material
To view supplementary material for this article, please visit https://doi.org/10.1017/S0022149X22000694.
Acknowledgements
We are grateful for the advice received from Jonathan Cracknell, Head of Living Collection and Jen Quayle, Veterinarian at Knowsley Safari (KS). We thank KS animal keepers during surveys who helped supervise our team's safety.
Financial support
This work forms part of the MSc research dissertations of Scott Barlow and Hannah Williams. Since Alex Juhasz, Sam Jones and Lucas Cunningham receive salary support from the Wellcome Trust, these surveys were therefore supported, in part, by the National Institute for Health Research (NIHR) (using the UK’s Official Development Assistance (ODA) Funding) and Wellcome Trust [220818/Z/20/Z] under the NIHR-Wellcome Partnership for Global Health Research. The views expressed are those of the authors and not necessarily those of Wellcome, the NIHR or the Department of Health and Social Care.
Conflicts of interest
None.
Ethical standards
The authors assert that all procedures contributing to this work comply with the ethical standards of the relevant national and institutional guides on the care and use of invertebrates.
Author contributions
Inception and design of the study: BJ, NDW, EJLaC and JRS; snail collection and characterization: AJ, SEJB, HW, SJ, BJ, NDW and JRS; molecular cox1 barcoding and analyses: AJ, SEJB, HW, LCC, SJ and JRS; first draft of the paper: AJ, SEJB and HW; and all authors contributed writing, editorial revision and final approval of the manuscript.



