Introduction
Worldwide, pineapple exports in 2022 were among the three most traded tropical fruits, reaching 3.1 million tons (FAO, 2023). The main consumers are the USA with 3.62 kg/capita, followed by Canada with 3.30 kg/capita and Europe with an average consumption of 1.26 kg/capita, thus accounting for 76% of the market share (CIRAD, 2022). In Peru in 2021, according to the Integrated Agricultural Statistics System (SIEA, 2021), pineapple production was 588,398 tons, with a total harvested area of 16,836 ha: a yield of 34,949 kg/ha. The main producer was the Junin region, which produced 442,629 tons, with a total harvested area of 6,668 ha and a yield of 66,381 kg/ha. Junin maintained its pineapple production dominance throughout 2022 and 2023 (January–November), generating 402,049 and 404,251 tons, respectively, showing a slight downward trend of 0.54% in production.
Unfortunately, world pineapple production is seriously threatened by mealybugs, which transmit viruses that cause mealybug wilt of pineapple (MWP) disease (Sether et al., Reference Sether, Melzer, Busto, Zee and Hu2005; Wei et al., Reference Wei, Peng, He, Lu and Wang2020). In fact, yield decline of up to 40% due to pineapple mealybug wilt-associated virus (PMWaV)-2 infection has been reported (Borroto-Fernández et al., Reference Borroto-Fernández, Torres-Acosta and Laimer2007). When infection occurs in the early months of planting, it reduces average fruit weight by up to 55% and by 35% for infections in late stages (Sether and Hu, Reference Sether and Hu2002). In addition, asymptomatic PMWaV-1 infection causes losses of up to 30% due to premature fruit ripening (Sipes et al., Reference Sipes, Sether and Hu2002).
The main pests of pineapple worldwide are mealybugs, belonging to the order Hemiptera, family Pseudococcidae (Dey et al., Reference Dey, Green, Melzer, Borth and Hu2018). Dysmicoccus brevipes (pink mealybug) and D. neobrevipes (grey mealybug) are both native to tropical South and Central America (Beardsley, Reference Beardsley1992). These two species, with similar morphology, are considered extremely serious invasive pests (Wei et al., Reference Wei, Peng, He, Lu and Wang2020).
The polyphagous species D. brevipes infests a wide range of plants (53 families) including economically important crops and ornamentals such as coconut, avocado, mango, oil palm, citrus, cotton, coffee, cocoa, banana, apple, and pineapple (Ben-Dov, Reference Ben-Dov1994). Pineapple (Ananas comosus L. Merr.) is a monocotyledonous plant of the order Bromeliales and family Bromeliaceae. In the provinces of Satipo and Chanchamayo, in the Junin region, the main pineapple cultivars grown are Cayena Lisa, Samba, Pucalpina, Hawaiiana, and the MD2 hybrid. In infested pineapple plants, D. brevipes is found at the base of the stem, crown, root, and leaves. These pests feed on the plant by sucking the sap and causing symptoms such as yellowing of the leaves, defoliation, shoot abortion, size reduction, fruit deformation, and in some cases the death of the plant (Suma et al., Reference Suma, Mazzeo, La Pergola, Nucifora and Russo2015). In addition, mealybugs produce honeydew that covers the fruit generating an environment conducive to fungal infection, reducing the photosynthetic rate and consequently reducing fruit marketability (Qin et al., Reference Qin, Wu, Qiu, Ren and Ali2011).
However, the greatest threat is that these pests act as vectors of viruses. Dysmicoccus brevipes and D. neobrevipes are known vectors that transmit MWP disease (Sether et al., Reference Sether, Melzer, Busto, Zee and Hu2005), a disease caused by a species of viruses called PMWaV-1, -2, and -3, which are recognised by the International Committee on Taxonomy of Viruses, and the putative PMWaV-4, -5, and -6 (Green et al., Reference Green, Rwahnih, Olmedo-Velarde, Melzer, Hamim, Borth and Hu2020; Larrea-Sarmiento et al., Reference Larrea-Sarmiento, Olmedo-Velarde, Wang, Borth, Matsumoto, Suzuki and Hu2021) belonging to the genus Ampelovirus of the family Closteroviridae (Sether et al., Reference Sether, Ullman and Hu1998). PMWaV-1, -2, and -3 have linear positive strand ssRNA genomes between 13,701 and 14,861 bp, and they code for 13 proteins. The 5ʹ end has a methylated nucleotide cap, while the 3ʹ end does not have a poly(A) tail. The genomic RNA is capped by capsid proteins giving a filamentous, flexuous shape about 1400–2200 nm in length and 10–13 nm in diameter (Green et al., Reference Green, Rwahnih, Olmedo-Velarde, Melzer, Hamim, Borth and Hu2020). Mealybug-transmitted wilt of pineapple attacks pineapple crops wherever they grow (Gambley et al., Reference Gambley, Steele, Geering and Thomas2008; Sether et al., Reference Sether, Borth, Melzer and Hu2010). These viruses generally cause symptoms of reddening, yellowing, apical necrosis, and stunting (Sether and Hu, Reference Sether and Hu2002). In Latin America, PMWaV-1 and -3 have been reported in Mexico (Ochoa-Martínez et al., Reference Ochoa-Martínez, Uriza-Ávila, Rojas-Martínez and Rodríguez-Martínez2016), PMWaV-1, -2, and -3 in Cuba (Hernandez-Rodriguez et al., Reference Hernandez-Rodriguez, Ramos-Gonzalez, Garcia-Garcia, Zamora, Peralta-Martin, Peña and Ferriol2014), PMWaV-1 in Ecuador (Alvarez et al., Reference Alvarez, Martin and Quito-Avila2015), PMWaV-2 in Brazil (Peron et al., Reference Peron, Calloni, Ventura and Fernandes2017), and recently PMWaV-1, -2, and -3 in Colombia (Moreno et al., Reference Moreno, Rodríguez-Arévalo, Tarazona-Velasquez and Kondo2023) and Peru (Carrasco-Lozano et al., Reference Carrasco-Lozano, Carrillo-Ordóñez, Gamarra-Gamarra, Torres-Suarez, Villar, Stange and Valverde2023).
To control the mealybug, a variety of approaches have been attempted such as destroying residues of the previous crop and alternate hosts and drowning the pests by abundant irrigation (Arellano et al., Reference Arellano, Vergara and Bello2015); however, this type of control has not been efficient. For a successful integrated pest management program, a thorough understanding of the crop production system and the ecology and biology of each pest or disease is critical (Mani and Shivaraju, Reference Mani, Shivaraju, Mani and Shivaraju2016). Therefore, the objective of the present study was to molecularly identify the mealybugs collected from the Hawaiiana cultivar and the MD-2 hybrid in the provinces of Satipo and Chanchamayo in Peru’s central jungle to determine if they are hosts of the PMWaV-1, -2, and -3 so that strategies for the integrated management of this pest could subsequently be developed.
Material and methods
Physiographic characteristics and collection of mealybug samples
We collected 136 samples of mealybug larvae in different stages and adults from symptomatic plants, specifically leaves and roots in pineapple production fields with the Hawaiiana cultivar and the MD-2 hybrid in the localities of San Martín de Pangoa, Alto Celendin, and Mazamari in the province of Satipo, and Alto Pichanaki in the province of Chanchamayo (table 1). These fields are in the Selva Alta, a climatic unit characterised by warm to temperate temperatures (14.5°C–25°C), rainfall ranging from 500 to 4,000 mm, and altitudes between 500 and 3,500 metres above sea level. Mealybug samples were preserved in Eppendorf tubes and liquid nitrogen for further analysis.
Collection site, altitude, pineapple cultivars, phenological stage of crop, symptoms in field, and PCR detection of PMWaV-1, -2, and -3 in mealybug samples

DNA and RNA extraction
Total genomic DNA extraction from adult mealybugs was performed using the innuPREP Blood DNA Kit (Analytik Jena) according to the manufacturer’s instructions. Subsequently, total RNA was obtained using TRIzol (Invitrogen™). Briefly, a pool of 250 mg of larvae in different stages and adult mealybugs were pulverised with liquid nitrogen to which 1 mL of TRIzol reagent was added. The mixture was then incubated at room temperature for 10 min. The aqueous phase was centrifuged and recovered; chloroform was then added to remove protein residues. Isopropanol was added to precipitate total RNA and the pellet obtained was washed with 75% ethanol. The pellet was re-suspended in 50 µL of RNase-free water and stored at −70°C. RNA quality was estimated using a 1% agarose gel and quantified with a spectrophotometer (ThermoScientific™).
Polymerase chain reaction of the Cytochrome oxidase I gene and ribosomal internal transcribed spacer region of mealybug
To identify mealybugs at the molecular level, polymerase chain reaction (PCR) amplification of two target regions was performed. The mitochondrial Cytochrome oxidase I (COI) gene was amplified using the universal primers LCO-1490 (5ʹGGTCAACAAATCATAAAGATATTGG 3ʹ) and HCO-2198 (5ʹTAAACTTCAGGGTGACCAAAAAAAAAATCA 3ʹ) primers (Hebert et al., Reference Hebert, Cywinska, Ball and DeWaard2003). Additionally, the ribosomal internal transcribed spacer (ITS) region, known to be highly variable and useful for differentiating closely related species, was amplified with primers specific for mealybugs, ITS2-M-F (5ʹCTCGTGACCAAAGAGAGTCCTG 3ʹ) and ITS2-M-R (5ʹTGCTTAAGTTCAGCGGGTAG 3ʹ) (Malausa et al., Reference Malausa, Fenis, Warot, Germain, Ris, Prado and Kreiter2011). PCR reactions were in a volume of 25 μL with 0.4 μM of each primer, 0.2 mM dNTPs, 2 mM MgCl2, 1 × PCR buffer, 0.05 U/μL of Taq DNA polymerase (ThermoScientific™), and 30 ng of total genomic DNA. Amplification parameters were executed at 94°C for 5 min, followed by 35 cycles at 94°C, annealing at 46°C for LCO-1490/HCO-2198 and 58°C for ITS2-M-F/R primers, and an extension phase of 72°C for 60 s. The final extension step conducted at 72°C for 5 min.
Detection by reverse transcription PCR of PMWaV-1, -2, and -3 viruses
To detect PMWaV-1, -2, and -3 in mealybug samples, cDNA was synthesised using the Maxima H Minus kit (ThermoScientific™) according to the manufacturer’s recommendations. Next, a 20 µL reverse transcription PCR (RT-PCR) reaction was performed with 5 µL of the cDNA, 0.2 mM dNTPs, 2 mM MgCl2, 1× PCR buffer, 0.05 U/μL of Taq DNA polymerase (ThermoScientific™), and 0.4 μM of primer sets 225/226 for PMWaV-1, 224/223 for PMWaV-2, and 264/263 for PMWaV-3 (Sether et al., Reference Sether, Melzer, Busto, Zee and Hu2005, Reference Sether, Melzer, Borth and Hu2009), which amplified a region of the Hsp70 gene. The parameters for amplification were 94°C for 5 min, followed by 35 cycles at 94°C for 60 s, 54°C for PMWaV-1 and PMWaV-2 and 55°C for PMWaV-3 for 60 s, with an extension phase of 72°C for 60 s, and a final extension step at 72°C for 10 min.
Sequencing and bioinformatics analysis
Fragments amplified by PCR with primers LCO-1490/HCO-2198 and ITS2-M-F/ITS2-M-R (seven samples for each set of primer) and primers for PMWaV-1, -2, and -3 (two samples for each virus) were purified from agarose gels using the Gel/PCR DNA Fragments Extraction Kit (Geneaid, Taiwan) according to the manufacturer’s instructions. The purified fragments were sequenced by the Sanger method at Macrogen (South Korea) in both directions with primers used for PCR. The sequences obtained were assembled using Geneious v8.1 software (Kearse et al., Reference Kearse, Moir, Wilson, Stones-Havas, Cheung, Sturrock and Drummond2012). For phylogenetic analysis of mealybugs and PMWaV-1, -2, and -3 viruses, a BLASTn analysis was performed, and the sequences with the highest identity percentages were downloaded for multiple alignments using the ClustalW program (Thompson et al., Reference Thompson, Higgins and Gibson1994). The phylogenetic tree was constructed with the MEGA11 program (Tamura et al., Reference Tamura, Stecher and Kumar2021) using the maximum likelihood method, Tamura-Nei model with 1000 bootstrap replicates for test of phylogeny. The GenBank accession numbers for the phylogenetic relationship of mealybug and PMWaV 1, -2, and -3 are listed in Supplementary Table 2. Planococcus citri haplotype H2 (GU134678) and Mint vein banding-associated virus isolate (KY381598) were used as out-groups.
Results
Hawaiiana pineapples cultivated in San Ramón de Pangoa and Alto Pichanaki exhibited symptoms such as yellowing, reddening, stunted growth, and necrotic leaf tips. Similarly, the MD-2 hybrid grown in Alto Celendin and Mazamari displayed comparable symptoms, accompanied by chlorotic halos (fig. 1A; table 1). Likewise, in both the cultivar Hawaiiana and hybrid MD-2, the presence of mealybug was observed mainly at the base of the leaves (fig. 1B, C), stems, and roots with characteristics described previously (Beardsley, Reference Beardsley1992; Wei et al., Reference Wei, Peng, He, Lu and Wang2020). Adult females were on average 6 mm long and 2 mm wide, wingless, pinkish, oval in shape and covered with a layer of white wax and filaments around the insect body (fig. 1D, E). For the molecular identification of mealybugs, we used the universal primers LCO-1490/HCO-2198 (Hebert et al., Reference Hebert, Cywinska, Ball and DeWaard2003), which generated amplicons of the mitochondrial COI gene with an unexpected size (image not shown). Whereas the specific primers ITS2-M-F/ITS2-M-R (Malausa et al., Reference Malausa, Fenis, Warot, Germain, Ris, Prado and Kreiter2011) amplified fragments of 800 bp of the ITS2 region (fig. 2A) in all samples analysed, from which at least one sample per locality and cultivar were selected for sequencing. Mealybug samples collected from the Hawaiiana cultivar in San Ramon de Pangoa (1ITS-HSMP and 3ITS-HSMP), Alto Pichanaki (6ITS-HAP), Alto Celendín (8ITS-HC), and the MD-2 hybrid from Alto Celendín (10ITS-MD2C and 12ITS-MD2C) and Mazamari (13ITS-MD2M) were positive for D. brevipes (Cockerell) (Beardsley, Reference Beardsley1992; Wei et al., Reference Wei, Peng, He, Lu and Wang2020).
Presence of mealybug in pineapple production fields in the province of Satipo. (a) Production field of hybrid MD-2 in the locality of San Ramon de Pangoa with yellowing, apical necrosis, and chlorotic halos symptoms; (b) presence of mealybug in plants of hybrid MD-2 and (c) cultivar Hawaiiana; (d) dorsal and (e) ventral view of the adult female body observed under a Carl Zeiss Stemi 305 stereomicroscope at 30× magnification.

PCR amplification of the ITS region and RT-PCR of the hsp70 gene of PMWaV-1, -2, and -3. (a) Amplified fragments of approximately 800 bp of the mealybug ITS region; (b) 590 bp fragments of PMWaV-1; (c) 610 bp fragments of PMWaV-2; and (d) 490 bp fragments of PMWaV-3. In a, b, c, and d, cultivar Hawaiiana wells: 1–3 San Ramon de Pangoa, 4–6 Alto Pichanaki, 7–9 Celendin; hybrid MD-2 wells: 10–12 Celendin, 13 Mazamari; M, 1 kb molecular weight marker; C, negative control.

Nucleotide sequences were deposited in the GenBank database under the following accession numbers: PP109489 (1ITS-HSMP), PP109488 (3ITS-HSMP), PP109490 (6ITS-HAP), PP109491 (8ITS-HC), PP109492 (10ITS-MD2C), PP109493 (12ITS-MD2C), and PP109494 (13ITS-MD2M). Due to suboptimal sequencing quality, the sequences submitted to GenBank are shorter than the fragments amplified by PCR. BLASTn analysis revealed that the isolates 1ITS-HSMP, 3ITS-HSMP, 6ITS-HAP, 8ITS-HC, 10ITS-MD2C, and 12ITS-MD2C shared an average identity of 98% with isolates from India, Taiwan, and China, and 97% identity with isolates from Japan. These isolates clustered together in a single clade on the phylogenetic tree (fig. 3A). In contrast, the 13ITS-MD2M isolate displayed 95% identity with the isolate from Japan and haplotype WN1, WN2 isolates from China, forming a separate cluster (fig. 3A; Supplementary Table 2).
Phylogenetic trees of the ITS region for D. brevipes isolates (a) and the hsp70 gene for PMWaV-1, PMWaV-2, and PMWaV-3 (b) are presented. Dysmicoccus brevipes isolates from Peru are marked in red, while PMWaV-1, PMWaV-2, and PMWaV-3 are indicated in black, light blue, and green, respectively. The H2 haplotype of Planococcus citri (GU134678) and the Mint vein banding-associated virus isolate (KY381598) served as out-group references for the respective trees.

All mealybugs collected at the study sites were positive for the presence of PMWaV-1, -2, and -3. RT-PCR analysis using primers 225/226, 224/223, and 264/263 (Sether et al., Reference Sether, Melzer, Busto, Zee and Hu2005, Reference Sether, Melzer, Borth and Hu2009) successfully amplified fragments of the expected sizes: 590 bp for PMWaV-1, 610 bp for PMWaV-2, and 490 bp for PMWaV-3 (fig. 2B–D) in mealybugs collected from the Hawaiiana cultivar and the MD-2 hybrid. Analysis of fig. 2B–D revealed the distribution of PMWaV-1, -2, and -3 in mealybugs collected from study locations. In the Hawaiiana cultivar, the San Ramón de Pangoa samples showed all three PMWaVs (sample 1), PMWaV-2 and PMWaV-3 (sample 2), and PMWaV-1 (sample 3). Alto Pichanaki samples had PMWaV-1 and PMWaV-3 (sample 4), all three PMWaVs (sample 5), and PMWaV-2 and PMWaV-3 (sample 6). Alto Celendín samples 7, 8, and 9 contained all three PMWaVs, whereas in the MD-2 hybrid, the Alto Celendín sample 10 showed PMWaV-2 and PMWaV-3, samples 11 and 12 contained all three PMWaVs, and the Mazamari sample 13 had PMWaV-1 and PMWaV-3. RT-PCR analysis revealed varying detection rates of PMWaV-1, -2, and -3 across the sampled locations. In Alto Celendin, PMWaV-3 exhibited the highest detection rate (63%), followed by PMWaV-1 (57%) and PMWaV-2 (47%). A similar trend was observed in Mazamari, with PMWaV-3 detected in 66% of samples, followed by PMWaV-1 (59%) and PMWaV-2 (38%). In Alto Pichanaki, PMWaV-3 (63%) was most prevalent, followed by PMWaV-2 (47%) and PMWaV-1 (37%). In San Ramon de Pangoa, PMWaV-2 had the highest detection rate (47%), followed by PMWaV-3 (44%) and PMWaV-1 (39%) (table 1).
For molecular identification, representative samples were selected from different locations and cultivars. Specific fragments of PMWaV-1, PMWaV-2, and PMWaV-3 amplified by RT-PCR from mealybugs collected on cultivar Hawaiiana: M1V1-SRP (PMWaV-1), M1V2-SRP (PMWaV-2), and M1V3-SRP (PMWaV-3) from San Ramón de Pangoa; hybrid MD-2: M10V2-AC (PMWaV-2) from Alto Celendín and M13V1-M (PMWaV-1) and M13V3-M (PMWaV-3) from Mazamari were sequenced. All sequenced samples were positive for PMWaV-1, -2, and -3. The samples M1V1-SRP and M13V1-M showed 94.08% identity with respect to the isolates OM388424 (PMWaV-1); M1V2-SRP and M10V2-AC showed 98.62% identity with OM388425 (PMWaV-2); and M1V3-SRP and M13V3-M showed 99.20% identity with OM388426 (PMWaV-3) (Supplementary Table 2). Phylogenetic analysis (fig. 3B) demonstrated that the isolates studied show genetic diversity associated with their geographic origin. Isolates M13V1-M and M1V1-SRP (PMWaV-1) were genetically closer to isolates from Cuba and Peru. Isolates M10V2-AC and M1V2-SRP showed a closer relationship with isolates from Cuba, while isolates M13V3-M and M1V3-SRP clustered with isolates from Cuba and Ghana.
Discussion
Mealybugs collected from the Hawaiiana cultivar and MD-2 hybrid production fields in the provinces of Satipo and Chanchamayo (Junin department, Peru) displayed morphological characteristics consistent with previous descriptions (Beardsley, Reference Beardsley1992). However, differentiating between D. brevipes and D. neobrevipes based on morphology proved challenging due to their similar characteristics (Wei et al., Reference Wei, Peng, He, Lu and Wang2020). To distinguish closely related species within the Pseudococcidae family, several studies have employed the DNA barcoding molecular approach (Correa et al., Reference Correa, Germain, Malausa and Zaviezo2012; da Silva Vc et al., Reference da Silva Vc, Bertin, Blin, Germain, Bernardi, Rignol and Malausa2014; Hebert et al., Reference Hebert, Cywinska, Ball and DeWaard2003; Malausa et al., Reference Malausa, Fenis, Warot, Germain, Ris, Prado and Kreiter2011). Common DNA markers include the ribosomal 18S, 28S, EF1-α (elongation factor 1 alpha), COI genes (Hebert et al., Reference Hebert, Cywinska, Ball and DeWaard2003; Rung et al., Reference Rung, Scheffer, Evans and Douglass2008), and ITS1 and ITS2 regions (Malausa et al., Reference Malausa, Fenis, Warot, Germain, Ris, Prado and Kreiter2011). We used the COI gene for the molecular characterisation of mealybugs. However, the primers LCO-1490 and HCO-2198 exhibited a Tm difference exceeding 5°C, which is not recommended. This discrepancy made it difficult to obtain fragments of the expected size, resulting in low-quality sequencing for bioinformatic analyses. Amplification using the ITS region primers ITS2-M-F/ITS2-M-R (Malausa et al., Reference Malausa, Fenis, Warot, Germain, Ris, Prado and Kreiter2011) was subsequently used, which identified the mealybugs as D. brevipes. This finding is further supported by the phylogenetic analysis (fig. 3A). Phylogenetic analyses revealed that isolates 12ITS-MD2C, 10ITS-MD2C, 6ITS-HAP, 1ITS-HSMP, and 3ITS-HSMP clustered closely with isolates from China belonging to haplotype QH. Isolate 8ITS-HC was most closely associated with a Chinese isolate of haplotype QJ. On the other hand, isolate 13ITS-MD2M clustered with a Chinese isolate of haplotype WN1. Taken together, these results suggest a diversity of mealybugs in the study areas.
Vegetative propagation of the pineapple crop cultivar Hawaiiana in the province of Satipo. (a) Sun-drying of the suckers to heal the wound generated when removing the shoot; (b) planting of the suckers in new fields; (c) crop fields of healthy cultivar Hawaiiana with symptoms of yellowing, reddening, apical necrosis, and dwarfism in the locality of Alto Pichanaki, province of Chanchamayo.

Although pineapple cultivation in Peru’s central jungle faces a variety of pests, mealybugs are the most problematic (Arellano et al., Reference Arellano, Vergara and Bello2015; Chellappan et al., Reference Chellappan, Viswanathan, Mohan and Mani2022). Our results provide evidence that mealybugs can harbour multiple strains of PMWaV, suggesting their potential role as vectors of the MWP complex (Gambley et al., Reference Gambley, Steele, Geering and Thomas2008; Sether and Hu, Reference Sether and Hu2002). Our results also agree with those reported recently in which PMWaV-1, -2, and -3 and mixed infections were detected in both plant samples and mealybugs collected in the Department of Valle del Cauca, Colombia (Moreno et al., Reference Moreno, Rodríguez-Arévalo, Tarazona-Velasquez and Kondo2023).
While some samples lacked detectable PMWaV-1, -2, and -3, the mealybug wilt disease (MWP) complex in pineapple can involve other PMWaVs. Putative PMWaV-4, PMWaV-5 (Green et al., Reference Green, Rwahnih, Olmedo-Velarde, Melzer, Hamim, Borth and Hu2020), and PMWaV-6 (Larrea-Sarmiento et al., Reference Larrea-Sarmiento, Olmedo-Velarde, Wang, Borth, Matsumoto, Suzuki and Hu2021) cause similar symptoms to PMWaV-1, -2, and -3. Additionally, Pineapple bacilliform CO virus-HI1 (PBCOV-HI1) and its nine genomic variants (A through H) (genus Badnavirus, family Caulimoviridae) have been reported, transmitted by D. brevipes (Sether et al., Reference Sether, Melzer, Borth and Hu2012). Considering the symptoms observed in the fields (figs. 1A and 4C) and the presence of PMWaV-1, -2, and -3 in the study localities, we hypothesise that pineapple production in these areas could also be affected by other variants of the PMWaV complex (PMWaV-4, -5, and -6) or Badnaviruses. Therefore, we recommend further studies to identify these potential pathogens.
What is obvious from our study is that D. brevipes is a threat to pineapple production in Satipo and Chanchamayo provinces. Under the current climate change scenario, rising temperatures associated with climate change may influence D. brevipes by (1) shortening life cycle: warmer temperatures can potentially accelerate development, leading to more generations per year; (2) increasing population growth rates: warmer temperatures might favour faster reproduction and population growth; and (3) enhancing dispersal: climate change could influence wind patterns and weather events, potentially impacting the spread of D. brevipes (Chellappan et al., Reference Chellappan, Viswanathan, Mohan and Mani2022; Wei et al., Reference Wei, Peng, He, Lu and Wang2020).
The geographical variations, thermal characteristics, and ecological conditions across locations like Alto Celendin, Mazamari, San Ramon de Pangoa, and Alto Pichanaki (Satipo and Chanchamayo) could further influence D. brevipes life cycle (Honêk, Reference Honêk2013). For instance, a study of table grapes (Bertin et al., Reference Bertin, Lerin, Botton and Parra2019) showed D. brevipes thriving between 8°C and 35°C, with an optimum at 30°C. This could accelerate their life cycle and potentially increase generations from three to five per year, potentially explaining the high mealybug incidence observed in the sampled fields. Furthermore, D. brevipes can survive on alternative hosts like citrus, banana, cacao, coffee, ginger, and mango (Ben-Dov, Reference Ben-Dov1994) when pineapple is not available. These alternative hosts are widely cultivated in Satipo and Chanchamayo, providing a refuge for D. brevipes populations between pineapple growing seasons.
Our observations at the sampled locations indicate another potential factor contributing to the spread of PMWaVs. Farmers commonly use suckers obtained from mother plants in other production fields, often after a 1-month solarisation process (fig. 4A, B). This practice can inadvertently spread PMWaVs because these viruses are systemic within infected plants (Sether et al., Reference Sether, Ullman and Hu1998). Suckers, stems, leaves, fruits, and roots can all serve as sources of inoculum for neighbouring fields, potentially explaining the observed symptoms (fig. 4C). To mitigate this problem and ensure the sustainability of the Hawaiiana cultivar and MD-2 hybrid pineapple production in Junin, Peru, we recommend the following: (1) apply stricter quarantine measures to prevent and minimise the spread of D. brevipes to other pineapple growing regions (Paini et al., Reference Paini, Sheppard, Cook, De Barro, Worner and Thomas2016); (2) encourage farmers to obtain vegetative seeds (suckers) from certified virus-free production fields; and (3) promote the use of seedlings derived from in vitro meristem culture, a technique known to produce virus-free plants (Delgado-Haya, Reference Delgado-Haya2020). These combined approaches can significantly reduce the dispersal of PMWaVs and ensure the health of pineapple crops.
Supplementary material
The supplementary material for this article can be found at https://doi.org/10.1017/S000748532510014X.
Acknowledgements
We wish to thank the Vice Rector’s Office of the Universidad Nacional del Centro del Peru.. We are especially grateful to Diane Greenstein for her excellent proofreading of the manuscript’s English.
Financial support
This research was supported by CANON Projects, resolution no. 3367-R-2020.
Competing interests
The authors declare no conflict of interest.




