Introduction
Pharyngodon Diesing, 1861 (Nematoda: Pharyngodonidae) is composed mainly of species that parasitize lizards of the families Gekkonidae, Liolaemidae, Phrynosomatidae, Scincidae, and Teiidae, and by two species that parasitize frogs in India (see Ajala Reference Ajala2015; Baker Reference Baker1987; Bursey and Goldberg Reference Bursey and Goldberg1996, Reference Bursey and Goldberg1999; Fenner et al. Reference Fenner, Smales and Bull2008). Around 32 species distributed across most zoogeographic regions are recognized for this genus (see Bursey and Goldberg, Reference Bursey and Goldberg1996, Reference Bursey and Goldberg1999; Bursey et al. Reference Bursey, Goldberg and Kraus2008; Fenner et al. Reference Fenner, Smales and Bull2008). Until now, five of these species are recognized in the Neotropical region (Bursey et al. Reference Bursey, Goldberg and Kraus2008; Fenner et al. Reference Fenner, Smales and Bull2008; Pereira Reference Pereira1935; Vicente et al. Reference Vicente, Rodrigues, Gomes and Pinto1993).
Besides the original descriptions, most Pharyngodon spp. records in Brazil lack taxonomic data (see Araújo Filho et al. Reference Araújo Filho, Teixeira, Teles, Rocha, Almeida, Mesquita and Lacerda2020; Ávila et al. Reference Ávila, Souza and Silva2010; Ávila and Silva Reference Ávila and Silva2010; Brito et al. Reference Brito, Corso, Almeida, Ferreira, Almeida, Anjos, Mesquita and Vasconcellos2014a, Reference Brito, Ferreira, Ribeiro, Anjos, Almeida, Mesquita and Vasconcellosb; Guimarães Reference Guimarães1975; Lopes et al. Reference Lopes, Silva, Datas and Almeida2007; Mesquita et al. Reference Mesquita, Oliveira, Perez and Ávila2020; Rocha Reference Rocha1995; Silva et al. Reference Silva, Manoel, Uieda, Ávila and Silva2019; Teixeira et al. Reference Teixeira, Riul, Brito, Araujo-Filho, Teles, Almeida and Mesquita2020; Xavier et al. Reference Xavier, Anjos, Gazêta, Machado, Storti-Melo and Dias2019). Until now, taxonomic studies with representatives of this genus that integrate morphological and molecular analyses are nonexistent.
In this context, this study aims to describe a new species of Pharyngodon found in Ameivula ocellifera (Spix, 1985) collected during a helminthological survey on lizards in a Caatinga area in the Vale do São Francisco, state of Pernambuco, Brazil, and carry out the first phylogenetic assay that includes a species of Pharyngodon.
Material and methods
Collection and examination of nematodes
During a helminthological ecological survey of lizards, 70 individuals of A. ocellifera were collected between March 2017 and March 2019 in a Caatinga morphoclimatic domain of the Petrolina municipality, Vale do Rio São Francisco, Pernambuco state, Brazil. The lizards were collected manually and with pitfall traps in the Projeto de Irrigação Senador Nilo Coelho, Núcleo 01 (09º23’79" S, 40º28’86" W). Hosts were identified following Oliveira et al. (Reference Oliveira, Gehara, São-Pedro, Chen, Myers, Burbrink, Mesquita, Garda, Colli, Rodrigues, Arias, Zaher, Santos and Costa2015), and representative specimens were deposited in the Coleção Herpetológica do Museu de Fauna da Caatinga (MFCH 5192-5223, MFCH 5.259-5.294).
Lizards were euthanized with an overdose of 10% ketamine associated with 2% xylazine hydrochloride, according to the recommendations of the Conselho Nacional de Controle de Experimentação Animal (2018). Necropsies were performed under a stereomicroscope. After collection, the live nematodes were placed in Petri dishes with 0.85% saline. Live parasites were fixed in a warm 4% formaldehyde solution, remaining for 15 days at room temperature, and posteriorly preserved in 70° GL ethanol for morphological studies.
For species identification, nematodes were clarified in Amann’s lactophenol, mounted on temporary slides, and analysed under an Olympus BX-41 light microscope equipped with a drawing tube and micrometric ocular at the Laboratorio de Helmintos Parasitos de Vertebrados (LHPV) of the Instituto Oswaldo Cruz (IOC), FIOCRUZ, Rio de Janeiro, Brazil. Measurements of parasites are given in micrometres, unless otherwise indicated, and are presented as ranges followed by mean inside parentheses.
For scanning electron microscopy (SEM) analyses, five males and five females were dehydrated through a graded ethanol series, dried in 1,1,1,3,3,3-Hexamethyldisilazane 97% (HMDS) (Sigma-Aldrich), coated with gold, and observed under a JEOL JSM 6390LV microscope (operating 15 kV), at the Plataforma de Microscopia Eletrônica – Rudolf Barth, IOC, FIOCRUZ, Rio de Janeiro.
The species were identified by genus, following Anderson et al. (Reference Anderson, Chabaud and Willmott2009). The helminth prevalence, mean intensity, and mean abundance were calculated following Bush et al. (Reference Bush, Lafferty, Lotz and Shostak1997). Holotype, allotype, and paratypes were deposited in the Helminthological Collection of the Instituto Oswaldo Cruz (CHIOC), FIOCRUZ, Rio de Janeiro, Brazil.
Molecular characterisation and phylogenetic analyses
A part of the midregion of one adult male specimen was used to obtain genetic material. Genomic DNA was isolated using DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany), following the manufacturer’s protocol. Amplification of the 18S rDNA gene was performed using primers Nema18SF (5’-CGCGAATRGCTCATTACAACAGC-3’) and Nema18SR (5’-GGGCGGTATCTGATCGCC-3’) (Floyd et al. Reference Floyd, Rogers, Lambshead and Smith2005), and of the 28S rDNA gene was performed using primers 28srD1.2a (5’ – CCCSSGTAATTTAAGCATATTA – 3’) and 28srd4.2b (5’ – CCTTGGTCCGTGTTTCAAGACGG – 3’) (Whiting Reference Whiting2002). We tried to amplify the Cox1 of the mtDNA using the genetic markers proposed by Folmer et al. (Reference Folmer, Black, Hoeh, Lutz and Vrijenhoek1994), but we did not obtain suitable amplicons.
PCR reactions were performed with 2.5 μl of 10X PCR buffer minus MgCl2, 1.25μl of Mg Cl2 (50mM), 0.5 μl of dNTP’s (10 mM), 0.5 μl of each oligonucleotide primer (10 μM), 0.2 μl of Recombinant Taq DNA polymerase (5 U/μl) (Invitrogen), 1.25 μl of BSA (10 μg/μl), 16.3 μl of H2O, and 2.0 μl of genomic DNA (about 40 ng), in a final volume of 25 μl. PCR cycling conditions for the 18S sequences consisted of an initial denaturation at 94ºC for 5 min, followed by 35 cycles of 94ºC for 60 s, 54ºC for 60 s, 72ºC for 60 s, and a final extension step of 72ºC for 5 min; and for the 28S sequences consisted of an initial denaturation at 95ºC for 5 min, followed by 30 cycles of 94ºC for 60 s, 45ºC for 60 s, 72ºC for 60 s, and a final extension step of 72ºC for 5 min. Products were submitted to electrophoresis in 1% agarose gel in TBE buffer stained with ethidium bromide. PCR products were excised from the gel and purified with QIAquick® PCR & Gel Cleanup Kit (Qiagen), following the manufacturer’s protocol. The samples were sequenced using the BigDye Terminator version 3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) with the ABI 3730 DNA Analyzer in the Genomic Sequencing Platform of FIOCRUZ – Rio de Janeiro.
Consensus sequences were obtained using Bioedit 7.7.1.0 (Hall Reference Hall1999), subjected to BLAST search, in the NCBI database, for confirmation of the genetic proximity with other sequences of representative Pharyngodonidae, and posteriorly deposited in the GenBank database (see taxonomic summary).
Bayesian inference (BI) analyses were conducted in MrBayes version 3.2.7 (Ronquist and Huelsenbeck Reference Ronquist and Huelsenbeck2003). The concatenated sequence of 18S + 28S was assembled using DAMBE v.7.3.32 (Xia Reference Xia2017). For phylogenetics constructions, sequences of representative species of Pharyngodonidae published in previous studies and available in GenBank were used (see Table 1), and Dichelyne grandistomis (Ferraz & Thatcher, 1988) (Nematoda: Cucullanidae) (18S - KX752094, 28S - KX752093) was used as outgroup for rooting the trees. The genetic similarities and pairwise distances were obtained using Bioedit 7.7.1.0 and MEGA 11, respectively.
Representatives of Pharyngodonidae used in phylogenetic analysis, associated with host, locality, and GenBank accession codes
Sequence alignments were generated using MUSCLE tool in the MEGA 11 (Tamura et al. Reference Tamura, Stecher and Kumar2021) and trimmed. The best nucleotide substitution model was determined for 18S (GTR+I+G) and 28S (GTR+G) with model selection based on the Akaike information criterion (AIC) using JModelTest version 2.1.10 (Darriba et al. 2008). Posterior probability distributions were generated using the Markov chain Monte Carlo (MCMC) method. MCMC searches were run for 5 million generations on two simultaneous runs of four chains and sampled every 1,000 generations; the first 25% of samples from the MCMC algorithm were discarded as burn in. The quality of the Bayesian analysis (parameter densities, effective sample size, and burn-in) and the chain convergence were examined in Tracer v1.7 (Rambaut et al. Reference Rambaudt, Drummond, Xie, Baele and Suchard2018). For the analysis of the concatenated sequence, two partitions were created using the models suggested by JModelTest. Trees were visualized using Figtree version 1.4.4 (Rambaut 2012).
Results
Morphological description
Pharyngodon ameivulum n. sp.
Pharyngodon ameivulum n. sp., line drawing. A – Male, anterior region, ventral view. B – Female, anterior region, lateral view. C – Male, caudal region, ventral view. D – Male, optical section of cloacal region, lateral view. E – Male, cloacal region, laterial view. F – isolated eggs. G – Female, caudal region, ventral view.
Pharyngodon ameivulum n. sp., scanning electron micrographs. A – Male, anterior region, ventral view. B – Male, anterior end detail, latero-ventral view. C – Female, excretory pore and vulva region, ventral view. D – Male, posterior region, caudal alae and papillae, ventral view. E – Male, detail of tip of three pedunculate papillae. F – Male, detail of cloacal region, ventral view. G – Male, distal end of genital cone detail, latero-ventral view. (abbreviations: 1st – first pair of cauda papillae. 2nd – second pair of caudal papillae. 3rd – third pair of caudal papillae. a – amphid. cf – caudal filament. cl – cloacal aperture. cp – cephalic papilla. dl – dorsal lip. ep – excretory pore. la – lateral alae. lvl – latero ventral lip. v – vulva. *Papillae on the tip of v-shaped apparatus. Withe arrow - papillae on the tip of v-shaped apparatus).
General: Small, robust, whitish nematodes. Sexual dimorphism evident, males with approximately 55% of females total body length. Lateral alae present in males and females (Figures 1A–C, E; 2A, D, C). Buccal aperture triangular in both sexes, surrounded by three lips, with oesophageal internal cuticular projections reaching outer edge of buccal aperture. Dorsal lip with two papillae, and lateroventral lips with one papilla and one amphid in each (Figure 2B). Oxyuriform oesophagus, divided in corpus, isthmus and posterior bulb with valves (Figures 1A, B). Nerve ring at first third of oesophagus (Figures 1A, B). Excretory pore far posterior to oesophageal bulb (Figures 1A, B). Tail conical, with filament in males.
Male (based on 10 adult mature specimens): Total body length 1.78–2.08 (1.96) mm, body width at level of oesophagus-intestinal junction 105–175 (139.9). Oesophagus total length 309–387 (346); corpus 237–300 (273.9) long, oesophageal bulb 55–87 (71) long, and 55–80 (65) wide. Nerve ring 67–156 (137.5) and excretory pore 300–635 (555.25) from anterior end. Excretory pore with cuticular trabeculae. Lateral alae present, beginning at the level of the oesophageal bulb and ending at the beginning of the caudal alae. Cloacal lips smooth, without cuticular ornamentation (Figures 2D, F, G). Posterior region with a caudal alae extending into the three pairs of pedunculated papillae (Figures 1C–E, 2D–F), with its posterior part ending far distant from the last pair of caudal papillae. Accessory papillae absent. Caudal papillae pedunculate, with 1:1:1 distribution, where the first is pre-cloacal, with single tip; the second pair is ad-cloacal, bifurcate at the tip, with the protuberance of the papilla in the anterior bifurcation; and third pair is post-cloacal, with single tip (Figures 1C–E, 2D–F). Spicule absent. Gubernaculum absent. Genital cone 23–26 (24.4), with a subdorsal unpaired papilla, near to the tip of the cone (Figure 2F, G). V-shaped sclerotized apparatus present, with distal end contained into the genital cone (Figures 1C, D). Tail 155–166 (157.2) long (including caudal filament). Caudal filament apical (Figures 1C, 2D) 126–140 (139.4) long.
Female (Based on 10 adult mature specimens): Total body length 3.13–4,13 (3.56) mm, body width at level of oesophagus-intestinal junction 167–425 (263.4). Total oesophagus length 425–500 (466) mm; corpus 320–395(365), oesophageal bulb 95–105 (100) long, and 100–115 (105) wide. Nerve ring 135–157 (146.25) and excretory pore 490–830 (616) from anterior end. Excretory pore with cuticular trabeculae. Lateral alae present (Figure 2C), beginning at the level of oesophageal bulb, ending anterior from anus. Didelphic, opistodelphic. Vulva not prominent (Figure 2C), pre-equatorial, far posterior of oesophagus-intestinal junction, posterior and immediately near to excretory pore (Figure 1B), 445–990 (627) from anterior end, followed by long vagina direct posteriorly. Eggs flattened on one side (D-shaped), with both ends operculate and truncated (Figure 1F), early stages of cleavage in the ovijector, 112–150 (133.5) long, 22–50 (40.63) wide. Eggshell thin, without punctated surface. Tail conical, 260–650 (492) long, filament absent, corresponding approximately to 13.8% of total body size.
Taxonomic summary
Type host: Ameivula ocellifera (Spix, 1895) (Squamata: Teiidae)
Site of infection: Large intestine
Prevalence: 10% (7 infected hosts, 70 necropsied)
Mean intensity: 20.9±25.5
Mean Abundance: 2.1±10.2
Range of infections: 3–80
Type Locality: Projeto de Irrigação Senador Nilo Coelho, Núcleo 01 (09º23’79”S, 40º28’86”W), municipality of Petrolina, Caatinga morphoclimatic domain, state of Pernambuco, Brazil
GenBank accession: 18S rDNA partial sequence: PQ600367, 28s rDNA partial sequence: PQ628035
ZooBank registration: urn:lsid:zoobank.org:pub:E01ABCDF-DC1E-4A87-8115-9A51486D4069
Type specimens: Holotype male: CHIOC 39684a. Allotype female: CHIOC 39684b. Paratypes: CHIOC 39684c (5 males and 5 females). Hologenophore male: CHIOC 39684d.
Etymology: The specific name refers to the genus of the type host, Ameivula.
Remarks
In the family Pharyngodonidae Travassos, 1919, two genera present males with caudal alae and females with a pre-equatorial vulva posterior to the postbulbar excretory pore: Pharyngodon Diesing, 1861, and Spauligodon Skrjabin, Schikhobalova & Lagodovskaja, 1960. However, Pharyngodon presents males with caudal alae involving all caudal papillae, and in Spauligon, these caudal alae do not reach the last pair of papillae (Anderson et al. Reference Anderson, Chabaud and Willmott2009; Bursey and Goldberg Reference Bursey and Goldberg1999). Pharyngodon ameivulum n. sp. males have caudal alae bearing all caudal papillae, and females have a pre-equatorial vulva near to excretory pore, justifying its inclusion in this genus.
Pharyngodon species can be differentiated by the presence or absence of spicules and the number and arrangement of caudal papillae in males, morphology of the eggs in females, and the morphology of the adults’ tails (Bursey and Goldberg Reference Bursey and Goldberg1996, Reference Bursey and Goldberg1999; Fenner et al. Reference Fenner, Smales and Bull2008). The length of the males’ caudal filament in relation to the caudal alae size was not assessed in the current study, considering that some studies do not clearly present morphometric data of these structures.
Pharyngodon ameivulum n. sp. forms a group with 11 other species since those males do not have spicules, while females do not present tail spines (including tail filament) and have truncated eggs (Table 1) (see Adamson Reference Adamson1984; Baylis Reference Baylis1923, Reference Baylis1930; Binh et al. Reference Binh, Bursey and Goldberg2007; Hardwood Reference Harwood1932; Johnston and Mawson Reference Johnston and Mawson1942; Moravec et al. Reference Moravec, Baruš and Ryšavý1987; Pereira Reference Pereira1935; Read and Amrein Reference Read and Amrein1953; Solera-Puertas et al. Reference Solera-Puertas, Gonzalez-Santiago, Carvajal-Gallardo and Zapatero-Ramos1988; Specian and Ubelaker Reference Specian and Ubelaker1974).
The new species presents a bifurcated distal end of the papillae’s second peduncle (Figures 1C–E), similar to seven other species in the mentioned group (Table 1). This character distinguishes these species from P. travassosi Pereira, Reference Pereira1935; P. cnemidophori Read & Amrein, Reference Read and Amrein1953; P. kirbii Specian & Ubelaker, Reference Specian and Ubelaker1974; and P. warneri Hardwood, 1932 since they present a single tip in their second caudal peduncle (Table 1) (see Hardwood Reference Harwood1932; Pereira Reference Pereira1935; Read and Amrein Reference Read and Amrein1953; Specian and Ubelaker Reference Specian and Ubelaker1974).
Pharyngodon ameivulum n. sp. can be distinguished from some of the remaining seven species by the number and arrangement of caudal papillae (Table 2). Therefore, the new species has three pairs of caudal papillae, where the first is precloacal, the second is ad cloacal, and the third is postcloacal (arrangement 1:1:1) (Figures 1C, D, 2D), which differs from P. asterostoma Adamson, Reference Adamson1984; P. tiliquae Baylis, Reference Baylis1930; and P. hierrensis Solera-Puertas, Gonzáles-Santiago, Carvajal-Gallardo & Zapatero-Ramos, 1989 since these species have four pairs of papillae arranged in 1:2:1 (see Adamson Reference Adamson1984; Solera-Puertas et al. Reference Solera-Puertas, Gonzalez-Santiago, Carvajal-Gallardo and Zapatero-Ramos1988). Pharyngodon inermicauda Baylis, Reference Baylis1923; P. australis Johnston & Mawson, Reference Johnston and Mawson1942; and P. cesarpintoi Pereira Reference Pereira1935 also have three pairs of caudal papillae, but they differ from the new species by their arrangement. Pharyngodon australis and P. inermicauda have a 1:0:2 arrangement, lacking the ad cloacal papillae, while P. cesarpintoi has a 0:2:1 arrangement, lacking the precloacal papillae (Table 1) (see Johnston and Mawson Reference Johnston and Mawson1942; Moravec Reference Moravec, Baruš and Ryšavý1987; Pereira Reference Pereira1935).
Main differentiating features of species of Pharyngodon without spicules and tail spines, and with operculated truncated eggs
Pharyngodon ameivulum n. sp. and P. duci Binh, Bursey & Goldberg, Reference Binh, Bursey and Goldberg2007 share the most similar morphological and morphometrics features (see Table 1). However, we can differentiate P. ameivulum n. sp. from P. duci because the new species’ females have lateral alae and do not have a caudal filament (Figures 1A, E, G; 2C), different from P. duci females (see Binh et al. Reference Binh, Bursey and Goldberg2007).
Molecular characterization
The partial sequences of the 18S rDNA (601 bp) and 28S rDNA (1009 bp) obtained for P. ameivulum n. sp. represent the first genetic data of a Pharyngodon species. The partial 18S sequence indicates 93.8% similarity to Spauligodon carbonelli Roca & Garcia-Adell, 1988; Spauligodon saxicolae Sharpilo, 1961; and Spauligodon nicolauensis Jorge, Carretero, Perera, Harris & Roca, 2012, and the pairwise analysis showed that the new species differs by 0.0475–0.1010 from all available Pharyngodonidae sequences. Meanwhile, the partial 28S sequence indicates 71.7% similarity to Spauligodon carbonelli, with the pairwise analysis showing 0.2074–0.3251 difference from other isolates of this family.
A Bayesian-inference phylogenetic tree based on the 18S rDNA, 28S rDNA, and 18S + 28S concatenated demonstrated two main clades among the analysed representatives (Figures 3–5). In all trees, P. ameivulum n. sp. forms a fully supported major clade with species of Skrjabinodon Inglis, 1968 and Spauligodon (Figures 3–5). Within this clade, in the trees of 28S and 18S + 28S, P. ameivulum n. sp. occupies a fully supported basal lineage of the non-monophyletic clade composed of Skrjabinodon trimorphi and representatives of Spauligodon (Figures 4–5); the same was not observed in the 18S tree due to support value lower than 0.5 in this clade (Figure 3).
Bayesian-inference (BI) phylogram at the selected representatives of Pharyngodonidae inferred from the sequences 18s rDNA. The newly obtained sequence is in bold. Posterior probability (pp) values exceeding 0.49 are shown.
Bayesian-inference (BI) phylogram at the selected representatives of Pharyngodonidae inferred from the sequences 28s rDNA. The newly obtained sequence is in bold. Posterior probability (pp) values exceeding 0.49 are shown.
Bayesian-inference (BI) phylogram at the selected representatives of Pharyngodonidae inferred from the concatenated sequences 18s + 28s rDNA. The newly obtained sequence is in bold. Posterior probability (pp) values exceeding 0.49 are shown.
Discussion
The present study considered 33 valid species of Pharyngodon, including the new species described here, 31 of which are exclusive to lizards (see Binh et al. Reference Binh, Bursey and Goldberg2007; Bursey and Goldberg Reference Bursey and Goldberg1996, Reference Bursey and Goldberg1999; Bursey et al. Reference Bursey, Goldberg and Kraus2008; Fenner et al. Reference Fenner, Smales and Bull2008; current study), and two described in anuran hosts (see Ajala Reference Ajala2015; Baker Reference Baker1987). This number of valid species differs from the stated by Bursey et al. (Reference Bursey, Goldberg and Kraus2008) and Fenner et al. (Reference Fenner, Smales and Bull2008) since these studies included four species designated as species inquirenda by Bursey and Goldberg (Reference Bursey and Goldberg1996) (Pharyngodon boulengerula Ubelaker, 1965; P. elongata Markov & Bogdanov, 1961; P. sphaerodactyli Barus & Coy Otero, 1974; P. polypedatis Yamaguti, 1941) for not having described males, which are essential for differentiating between the genera Pharyngodon, Spauligodon and Skrjabindon (Anderson et al. Reference Anderson, Chabaud and Willmott2009).
Most studies reporting Pharyngodon species in the Neotropical region are relevant ecological helminthological studies or surveys but do not provide taxonomic data (Araújo Filho et al. Reference Araújo Filho, Teixeira, Teles, Rocha, Almeida, Mesquita and Lacerda2020; Ávila et al. Reference Ávila, Souza and Silva2010; Ávila and Silva 2010; Baker Reference Baker1987; Brito et al. Reference Brito, Corso, Almeida, Ferreira, Almeida, Anjos, Mesquita and Vasconcellos2014a,Reference Brito, Ferreira, Ribeiro, Anjos, Almeida, Mesquita and Vasconcellosb; Bursey and Goldberg Reference Bursey and Goldberg2008; Castillo et al. Reference Castillo, Acosta, Gonzales–Rivas and Ramallo2020; Guimarães Reference Guimarães1975; Lopes et al. Reference Lopes, Silva, Datas and Almeida2007; Mesquita et al. Reference Mesquita, Oliveira, Perez and Ávila2020; Rocha Reference Rocha1995; Silva et al. Reference Silva, Manoel, Uieda, Ávila and Silva2019; Teixeira et al. Reference Teixeira, Riul, Brito, Araujo-Filho, Teles, Almeida and Mesquita2020; Vicente et al. Reference Vicente, Rodrigues, Gomes and Pinto1993; Xavier et al. Reference Xavier, Anjos, Gazêta, Machado, Storti-Melo and Dias2019). As a result, there are no additional morphological and morphometric data for these Neotropical species, potentially indicating in this zoogeographical region.
In addition to the original descriptions (see Freitas and Ibáñez Reference Freitas and Ibáñez1963; Pereira Reference Pereira1935), taxonomic data about Pharyngodon in Neotropical hosts are restricted to the studies of Alho and Moura (Reference Alho and Moura1970) and Castillo et al. (Reference Castillo, González–Rivas and Acosta2022). The first reports P. cesarpintoi in Ameiva ameiva (Linnaeus, 1758) (Squamata, Teiidae) in the Cerrado morphoclimatic domain at the Planalto Central, Goiás state, Brazil. The second reports P. travassosi parasitizing the lizard Teius teyou (Daudin, 1802) (Sauria: Teiidae) for the first time in Argentina.
It is noteworthy that Pereira (Reference Pereira1935) does not mention where the type specimens of the described species were deposited. We searched for analysis these type specimens in the Helminthological Collection of the Instituto Oswaldo Cruz (CHIOC), and the Biological Collections indexed in SpeciesLink (2023), which includes the main Brazilian collections in its database, but there were no records of these types. Therefore, we state that the P. cesarpintoi and P. travassosi type specimens are currently missing. Therefore, we suggest that new sampling of type hosts in the type localities should be performed so that these species’ neotypes can be designated.
Another issue to be highlighted in Pharyngodon spp. taxonomic studies is the scarcity of details on the species’ cephalic and caudal regions since descriptions did not perform SEM analyses in the specimens. If this method of morphological study is used, characters hitherto not seen in the species are likely to be described. Most studies with this bias in this genus are related to P. mammilatus (Linstow, 1897), a lizard parasite from North Africa (see Abdel-Ghaffar et al. Reference Abdel-Ghaffar, Varjabedian, Fol, Talal, Al Quraishy and Abdel-Gaber2022; Amer and Bursey Reference Amer and Bursey2008; Ashour et al. Reference Ashour, Koura, El-Alfy and Abdel-Aal1992; Pereira et al. Reference Pereira, Luque and Tavares2017; Rabie et al. Reference Rabie, El-Din, El-Latif, Mohamed and Al-Hissin2014). However, from studies using SEM, Pereira et al. (Reference Pereira, Luque and Tavares2017) are the only ones with relevant update to P. mamillatus taxonomic diagnosis. The current study is also characterized as the first to use SEM to describe a Neotropical Pharyngodon species.
The detailing of the P. ameivulum n. sp males’ genital region allowed the observation of an unpaired papilla in the dorsal surface of the genital cone distal end (Figures 2F, G), which has not yet been described in other Pharyngodon species, probably because it is difficult to see in light microscopy. Therefore, it is prudent not to consider this structure as a differentiating character of species of Pharyngodon since more studies using SEM analyses should be performed on other species of the genus.
Pharyngodonidae family comprises 35 genera (Hodda Reference Hodda2022), of which seven have representatives with isolates in the GenBank (Batracholandros Freitas & Ibanez, 1965; Gyrinicola Yamaguti, 1938; Ozolaimus Dujardin, 1845; Parapharyngodon Chatterji, 1933; Thelandros Wedl, 1862; Spauligodon; and Skrjabinodon). The sequences of 18S rDNA and 28S rDNA from this study are the first of a representative of Pharyngodon in the GenBank. Our 18S, 28S rDNA nucleotide sequences and 18S + 28S concatenated sequence demonstrated phylogenetic trees similar with some studies with representatives of Pharyngodonidae (see Abdel-Ghaffar et al. Reference Abdel-Ghaffar, Varjabedian, Fol, Talal, Abdel-Gaber and Al Quraishy2020a; Pereira et al. Reference Pereira, Luque and Tavares2018; Solórzano-García et al. Reference Solórzano-García, Falcón-Ordaz, Parra-Olea and Pérez-Ponce de León2020; Walker et al. Reference Walker, Bolek, Zieman, Langford, Reyda and Jiménez2023). Our phylogenetic analysis demonstrated that Pharyngodon forms a distinct group in relation to Spauligodon and Skrjabinodon species, and that representatives of Spauligodon and Skarbinodon, respectively, do not form monophyletic clades.
The study by Walker et al. (Reference Walker, Bolek, Zieman, Langford, Reyda and Jiménez2023) on the phylogenetic position of Gyrinicola batrachiensis (Walton, 1929), based on concatenated sequences of the 18S rDNA and 28S rDNA genes, demonstrates the non-monophyly of Pharyngodonidae. Despite this evidence, due to the few sequences of representatives of Pharyngodonidae genera available in GenBank, we consider that more accurate analysis of the phylogeny of this group needs to be done by adding sequences of more genera and species of representatives of this family.
Sequences of Pharyngodonidae representatives in GenBank originating from taxonomic morphological studies are still scarce (see Abdel-Ghaffar et al. Reference Abdel-Ghaffar, Varjabedian, Fol, Talal, Abdel-Gaber and Al Quraishy2020a, Reference Abdel-Ghaffar, Varjabedian, Al Quraishy, Abdel-Gaber, Fol and Talalb; De Sousa et al. Reference De Sousa, Jorge, Carretero, Harris, Roca and Perera2018; Jorge et al. 2012, Reference Jorge, Perera, Roca, Carretero, Harris and Poulin2014; Malysheva Reference Malysheva2016; Pereira et al. Reference Pereira, Luque and Tavares2018; Solórzano-García et al. Reference Solórzano-García, Falcón-Ordaz, Parra-Olea and Pérez-Ponce de León2020; Walker et al. Reference Walker, Bolek, Zieman, Langford, Reyda and Jiménez2023), and most sequences were originated from non-taxonomic studies and are associated with an unidentified species. This becomes a hindrance for a better understanding of the phylogenetic relationships of the species in this group also supported by morphological features.
Acknowledgements
This study was financed in part by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior – Brasil (CAPES) – Finance Code 001. Antonio Carlos Santos Ferreira was supported by a Doctoral fellowship from CAPES. Fabiano M. Vieira was supported by Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco (FACEPE), state of Pernambuco, Brazil (Processes: DCR-0023-2.13/24 and APQ-0625-2.13/24) and by a research grant from Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) (Process: 303233/2024-9).
Competing interest
None.
Ethical standard
This study was conducted under the authorizations of the Sistema de Autorização e Informação em Biodiversidade (SISBIO) of the Instituto Chico Mendes de Conservação da Biodiversidade (ICMBio Nº 60274-1) and licenses of the Comitê de Ética no Uso de Animais (CEUA) of the UNIVASF (Number 0003/260218).
