Selective intrauterine growth restriction (sIUGR) occurs when the estimated fetal weight (EFW) of the smaller fetus of a pair of monozygotic (MZ) twins is less than the 10th percentile for the same gestational age. It represents an important contributor to perinatal mortality and morbidity in MZ twins, as well as being associated with a high risk of neurological damage in both fetuses (Gratacos et al., Reference Gratacos, Lewi, Munoz, Acosta-Rojas, Hernandez-Andrade, Martinez and Deprest2007; Valsky et al., Reference Valsky, Eixarch, Martinez, Crispi and Gratacos2010). Abnormal placental development and an unequal share of the placenta are considered to be the causes of sIUGR. The molecular mechanisms involved in discordant share of the placenta of MZ twins with sIUGR are unclear. Recent studies in singleton and animals suggest that CDKN1C and KCNQ1OT1, two imprinted genes, could affect placental development (Frost & Moore, Reference Frost and Moore2010; Nelissen et al., Reference Nelissen, van Montfoort, Dumoulin and Evers2011; Pateras et al., Reference Pateras, Apostolopoulou, Niforou, Kotsinas and Gorgoulis2009; Shukla et al., Reference Shukla, Sittig, Ullmann and Redei2011). However, these genes have been less studied in sIUGR. In this study, placental mRNA expressions of CDKN1C, KCNQ1OT1, and CDKN1C protein expression were investigated in MZ twin pairs with sIUGR to explore the pathogenesis of sIUGR.
Materials and Methods
The study was approved by the Hospital Ethics Committees of the First Affiliated Hospital of Sun Yat-Sen University and the Second Affiliated Hospital of Guangzhou Medical University, and informed consent from participants was obtained. All twin pairs included were delivered in these two hospitals from July 2013 to July 2015, and they were confirmed as monochorionic twin pairs by ultrasound examination at first trimester and monozygotic by postpartum short tandem repeat (STR) assay. Pregnancies complicated by twin-to-twin transfusion syndrome (TTTS), miscarriage, fetal death, severe congenital anomalies, and maternal complications were excluded. Placental tissues around the umbilical cord insertion were collected immediately after cesarean section, and maternal blood was washed off by phosphate buffered saline and immediately frozen in liquid nitrogen and stored at −80°C for DNA, RNA, and protein extraction. Some of the placental tissue was fixed with formalin for immunohistochemistry.
Each umbilical cord was labeled at delivery to identify the twin. The arteries and veins from each umbilical cord were catheterized with 1.5 mm plastic catheters and flushed with heparin saline solution at room temperature. Barium sulfate dyed with eosin was injected in arteries, while barium sulfate dyed with methylene blue was injected in veins. Digital photographs of placentas were taken perpendicularly to the chorionic surface. The placental area of each fetus was measured by following the margins demarcated by inter-twin anastomoses. The placental ratio of each twin was calculated as area of each placental portion/area of whole MC placenta × 100%.
DNA was extracted with MiniBEST Universal Genomic DNA Extraction Kit (TAKALA, Japan) and amplified with GeneMapper ID-X (Version 1.2) (Applied Biosystems, USA) to detect 19 autosomal STR loci and gender determination marker. If all the loci were identical, the probability of MZ would be up to 99.99%.
Placental total RNA was extracted with RNAiso Plus (TAKARA, Japan). First-strand cDNA was synthesized from 500 ng of DNase-treated total RNA using PrimeScript RT Master (TAKARA, Japan). CDKN1C and KCNQ1OT1 mRNA expressions were examined by quantitative real-time PCR (Q-PCR) analysis (SYBR Premix Ex TaqTM Kit, TAKARA, Japan and an ABI 7500 Real-Time PCR system, Applied Biosystems, Foster City, CA).
Primers were as follows: GAPDH: F-GCACCGTCAA GGCTGAGAAC, R- GGTGAAGACGCCAGTGGA. CDKN1C: F- CCCATCTAGCTTGCAGTCTCTT, R- CAGACGGCTCAGGAACCATT. KCNQ1OT1: F-GGGAGCTGTTGTCCCTTACC, R- TTCGGAGTGGT AACTGTGCC.
Expression values were calculated with the delta Ct method using the housekeeping gene GAPDH as the control.
Indirect immunohistochemical staining for all cases of formalin-fixed placental tissue was performed using the streptavidin-biotin-peroxidase complex method with an SP Rabbit HRP Kit (Cwbiotech, China). A rabbit polyclonal antibody (Abcam, UK) of CDKN1C was used at a 1:200 dilution as the primary antibody.
Stained sections were scanned on a digital pathology system (Olympus, Japan) both at 20× and 40× magnification. Integrated optic density (IOD) and total area of tissue stained with DAB were measured with the Image-Pro Plus 6.0 software (Media Cybernetics, Europe). Mean light density, obtained by dividing the IOD for the total area, was used to evaluate the intensity of staining.
Western blot analysis was performed on whole-tissue extracts. A total of 50 μg of protein was loaded on 10% SDS-PAGE gel, transferred to polyvinylidene difluoride (PVDF) membrane and blocked with 3% bovine serum albumi (BSA) in Tween tris-buffered saline (TTBS). CDKN1C was detected using a rabbit polyclonal anti-CDKN1C antibody (Abcam, UK), 1:1,000 and then incubated with a secondary antibody labeled with peroxidase. The blots were visualized by an enhanced chemiluminescence system and were measured with the ImageJ 1.43 software (National Institutes of Health, USA).
Statistical Analyses
Gestational age of each group is presented as the median; the other data are presented as the means ± SD. The results of continuous and categorical variables were analyzed with one-way ANOVA. Statistical analysis was performed with SPSS 17.0.
Results
Seventeen sIUGR and fifteen normal MZ twin pairs were included in this study. Clinical information is shown in Table 1. Placental ratios of three types of sIUGR are shown in Figure 1.
Clinical Information of MC Twins With and Without sIUGR

Note: *p < .05 compared with normal control.
Placental ratio of normal and sIUGR MZ twins. Note: A = normal MZ twins, B = Type I sIUGR, C = Type II sIUGR, D = Type III sIUGR. Dash lines showed the margins demarcated by inter-twin anastomoses. The birth weights and share of placenta were similar in normal control group. The share of placenta was less in the smaller fetus of the sIUGR group. Scale bar = 2 cm.
In the sIUGR group, placental CDKN1C mRNA expression showed no difference between larger and smaller fetuses while KCNQ1OT1 mRNA expression was significantly higher in the larger fetus (0.72 ± 0.43) than in the smaller fetus (0.36 ± 0.19; p < .05). The CDKN1C/KCNQ1OT1 mRNA ratio was lower in the larger fetus (2.92 ± 1.97) than in the smaller fetus (6.01 ± 3.54; p < .05). In the normal control group, placental CDKN1C mRNA showed no difference between larger and smaller fetuses either. But KCNQ1OT1 mRNA expression was significantly lower in the larger fetus (0.63 ± 0.32) than in the smaller fetus (1.08 ± 0.67), and CDKN1C/ KCNQ1OT1 mRNA ratio was higher (3.07 ± 1.95) in the larger fetus than in the smaller fetus (1.73 ± 1.07; p < .05) (Figure 2). Immunohistochemistry and western blotting showed that the mean light density of CDKN1C was higher in the smaller fetus than in the larger fetus in sIUGR group (p < .05), while no difference was shown in the control group (Figures 3 and 4).
mRNA expressions of CDKN1C and KCNQ1OT1 (*p < .05). Note: A = CDKN1C, B = KCNQ1OT1, C = CDKN1C/KCNQ1OT1 mRNA ratio.
Immunohistochemistry of CDKN1C in placenta (×400). Note: A = larger fetus of the sIUGR group, B = smaller fetus of the sIUGR group, C = larger fetus of the control group, D = smaller fetus of the control group. Scale bar = 50 μm.
Western blot of CDKN1C in placenta (*p < .05). Note: 1 = larger fetus of the sIUGR group, 2 = smaller fetus of the sIUGR group, 3 = larger fetus of the control group, 4 = smaller fetus of the control group.
Discussion
The etiology of sIUGR in MZ twins is not clear, yet the placenta is indispensable in the pathogenic mechanism of sIUGR. Placental dysplasia of the smaller fetus might be critical in MZ sIUGR (De Paepe et al., Reference De Paepe, Shapiro, Young and Luks2010; Gou et al., Reference Gou, Li, Zhang, Liu, Huang, Zhou and Fang2017; Lopriore et al., Reference Lopriore, Sueters, Middeldorp, Oepkes, Walther and Vandenbussche2007). Q-PCR, immunohistochemistry, and western blotting showed that CDKN1C and KCNQ1OT1 were expressed in MZ placentas, which indicated that CDKN1C and KCNQ1OT1 might be important during placental development.
CDKN1C is a paternally imprinted gene that encodes a potent inhibitor of several cyclin/Cdk complexes. CDKN1C is primarily expressed in terminally differentiated cells; it associates with G1 Cdks, and its overexpression causes a complete cell cycle arrest in the G1 phase. KCNQ1OT1 is a maternally imprinted gene, and its transcript is an unspliced long non-coding RNA. It interacts with chromatin and silences CDKN1C transcription through epigenetic modifications.
According to parental conflict theory, paternally imprinted genes suppress fetal growth, while maternally imprinted genes promote fetal growth (Diplas et al., Reference Diplas, Lambertini, Lee, Sperling, Lee, Wetmur and Chen2009). Expressions of paternally and maternally imprinted genes should be kept in balance to ensure the normal development of both placenta and embryo. Although CDKN1C mRNA expression showed no difference between the larger and smaller fetuses in the sIUGR group, CDKN1C protein expression was higher in the smaller fetus than the larger fetus. CDKN1C was reported to increase in IUGR placentas of human singletons (McMinn et al., Reference McMinn, Wei, Schupf, Cusmai, Johnson, Smith and Tycko2006; Unek et al., Reference Unek, Ozmen, Ozekinci, Sakinci and Korgun2014). Animal studies have shown that CDKN1C protein staining was stronger in placentas of IUGR rats induced with dexamethasone (Unek et al., Reference Unek, Ozmen, Kipmen-Korgun and Korgun2012), and CDKN1C over-expressing animals have significantly smaller placental weight and fetal growth restriction (Andrews et al., Reference Andrews, Wood, Tunster, Barton, Surani and John2007; Serman et al., Reference Serman, Vlahovic, Sijan, Bulic-Jakus, Serman, Sincic and Katusic2007). These results showed some similarity with our study. Our results showed that placental KCNQ1OT1 expression decreased in smaller fetuses of the sIUGR group but increased in smaller fetuses of the control group. There were some similar discoveries in animal studies.
CDKN1C-knockdown rats and KCNQ1OT1-imprinting-loss rats showed the same pathologic changes, such as placental hypertrophy, trophoblast hyperplasia, and mesenchymal dysplasia (Armes et al., Reference Armes, McGown, Williams, Broomfield, Gough, Lehane and Lourie2012; Du et al., Reference Du, Zhou, Beatty, Weksberg and Sadowski2004; Shukla et al., Reference Shukla, Sittig, Ullmann and Redei2011). The previous studies and our study showed that sIUGR smaller fetuses had a smaller share of the placenta (De Paepe et al., Reference De Paepe, Shapiro, Young and Luks2010; Gou et al., Reference Gou, Li, Zhang, Liu, Huang, Zhou and Fang2017; Lopriore et al., Reference Lopriore, Sueters, Middeldorp, Oepkes, Walther and Vandenbussche2007). Increased CDKN1C protein and/or insufficient KCNQ1OT1 expression might play an important role in the placental dysplasia of the sIUGR smaller fetus.
The CDKN1C/KCNQ1OT1 mRNA ratio in this study could intuitively reflect the expression balance between paternally and maternally imprinted genes. In the sIUGR group, the CDKN1C/KCNQ1OT1 mRNA ratio was almost twice as high in the smaller fetus than in the larger fetus, but in the control group, it was only 50% in the smaller fetus. It indicated that CDKN1C expression was dominant in sIUGR smaller fetuses, and this might be closely related to a poorly developed placenta. CDKN1C expression was found to increase more than IGF-2 in placentas of IUGR rats induced by alcohol: CDKN1C/IGF-2 mRNA ratio was 1.5 in IUGR rats and 0.9 in the control group (Shukla et al., Reference Shukla, Sittig, Ullmann and Redei2011).
According to our results, we speculate that CDKN1C protein expression of the smaller fetus in sIUGR increases secondarily to the decreased expression of KCNQ1OT1, and CDKN1C over-expression causes early termination of trophoblast proliferation, which in turn might cause placental dysplasia. Contrarily, in the normal MZ group, the expression of KCNQ1OT1 in the smaller fetus increases; this might compensate placental development; therefore, the birth weight discordance is small.
CDKN1C protein and KCNQ1OT1 mRNA are expressed differentially in larger and smaller fetuses in the placenta of MZ with sIUGR. The pathogenesis of sIUGR may be related to the co-effect of the up-regulated protein expression of CDKN1C and down-regulated expression of KCNQ1OT1 mRNA in the placenta. The imbalanced expression between CDKN1C and KCNQ1OT1 may be involved in the unequal placental development in sIUGR.
Acknowledgments
We thank Professor Lanzhen Zhang, Professor Zhiqiong Liao, and Professor Yu Gao for placenta collection, and Ms Junhong Chen for clinical data collection. National Nature Science Foundation of China (Grant no.8127075); Science and Technology Planning Project of Guangzhou, China (1563000549); Research Fund for the Doctoral Program of Guangzhou Medical University (2015C16) have provided financial support.
Ethical Approval
The study was approved by the Hospital Ethics Committees of the First Affiliated Hospital of Sun Yat-Sen University and the Second Affiliated Hospital of Guangzhou Medical University.
