Introduction
The family Aphelenchoididae Skarbilovich, 1947, belonging to the superfamily Aphelenchoidoidea (sensu Hodda, Reference Hodda and Zhang2011), is notable for its species-rich genus Aphelenchoides Fischer, 1894, which contains approximately 200 nominal species (Fang et al., Reference Fang, Gu, Ma and Li2024). Historically, Aphelenchoides has been a genus of great interest due to its wide distribution, biological diversity, and economic significance. Members of this genus inhabit diverse ecosystems, including soil, mosses, decaying organic matter, and plant tissues, with their feeding behaviours ranging from mycetophagy to facultative or obligate plant parasitism (Manzanilla-López & Marbán-Mendoza, Reference Manzanilla-López and Marbán-Mendoza2012; Sánchez-Monge et al., Reference Sánchez-Monge, Janssen, Fang, Couvreur, Karssen and Bert2017).
While most species in the genus Aphelenchoides are primarily fungal feeders, some have evolved into plant pathogens, posing significant threats to agricultural productivity (Sánchez-Monge et al., Reference Sánchez-Monge, Janssen, Fang, Couvreur, Karssen and Bert2017). For example, A. besseyi Christie, Reference Christie1942, A. fragariae (Ritzema Bos, 1890) Christie, Reference Christie1932, and A. ritzemabosi (Schwartz, 1911) Steiner and Buhrer, 1932, are among the most studied plant-parasitic nematodes due to their substantial impacts on crop yields (Jones et al., Reference Jones, Haegeman, Danchin, Gaur, Helder, Jones, Kikuchi, Manzanilla‐López, Palomares‐Rius, Wesemael and Perry2013; McCuiston et al., Reference Mccuiston, Hudson, Subbotin, Davis and Warfield2007). These nematodes are often referred to as foliar and bulb nematodes. They are capable of infecting aerial parts of plants, resulting in yield loss and reduced marketability, particularly in ornamental plants and nursery crops (McCuiston et al., Reference Mccuiston, Hudson, Subbotin, Davis and Warfield2007; Sánchez-Monge et al., Reference Sánchez-Monge, Janssen, Fang, Couvreur, Karssen and Bert2017).
Despite its economic and ecological importance, the taxonomy of Aphelenchoides remains challenging due to the genus’s morphological conservation, significant intra-specific variation, and limited inter-specific diagnostic traits (Handoo et al., Reference Handoo, Kantor and Carta2020). Morphological characters such as stylet, lateral field, and body measurements have traditionally been used to delimit species. However, these traits often overlap among species, complicating accurate identification (Handoo et al., Reference Handoo, Kantor and Carta2020; Sánchez-Monge et al., Reference Sánchez-Monge, Janssen, Fang, Couvreur, Karssen and Bert2017). For example, while most species of Aphelenchoides possess a lateral field with four incisures, the presence of six incisures, as observed in certain populations, is considered rare and has been a subject of taxonomic debate (Handoo et al., Reference Handoo, Kantor and Carta2020; Shahina, Reference Shahina1996). Additionally, many nominal species have been insufficiently described or lack associated molecular data, further hindering reliable species identification (Fang et al., Reference Fang, Gu, Ma and Li2024; Handoo et al., Reference Handoo, Kantor and Carta2020; Sánchez-Monge et al., Reference Sánchez-Monge, Janssen, Fang, Couvreur, Karssen and Bert2017).
The application of molecular tools has significantly enhanced our ability to resolve taxonomic ambiguities within Aphelenchoides. By integrating morphological and molecular characterizations, recent studies have successfully identified cryptic species and clarified phylogenetic relationships within the genus (Fang et al., Reference Fang, Gu, Ma and Li2024; Handoo et al., Reference Handoo, Kantor and Carta2020). For instance, molecular data have facilitated the transfer of species between genera, such as the reclassification of Laimaphelenchus heidelbergi and Tylaphelenchus christinae into Aphelenchoides, while others like A. subtenuis and A. arachidis were moved to Robustodorus (Carta et al., Reference Carta, Li, Skantar and Newcombe2017; Kanzaki et al., Reference Kanzaki, Shokoohi, Fourie, Swart, Muller and Giblin-Davis2018).
Recent years have also witnessed a growing recognition of Aphelenchoides as a significant agricultural pest. Beyond its traditional association with fungal feeding, the genus has been implicated in damaging over 700 plant species across 85 botanical families (Handoo et al., Reference Handoo, Kantor and Carta2020; Kohl, Reference Kohl2011).
In Vietnam 23 species of the genus Aphelenchoides associated with 18 plants have been reported, of which 6 species were found associated with rice, i.e., Aphelenchoides paranechaleos Hooper and Ibrahim, 1994, A. besseyi Christie, Reference Christie1942, A. composticola Franklin, 1957, A. goodeyi Siddiqi and Franklin, 1967, A. paranechaleos Hooper and Ibrahim, 1994, and A. saprophilus Franklin, 1957 (Nguyen et al., Reference Nguyen, Trinh, Nguyen, Le and Bert2023b). In this study, we describe a new species, Aphelenchoides vinhphucensis sp. n., associated with rice in Vietnam. Rice, as a staple crop, is of immense agricultural and economic importance globally, and the identification of a novel nematode species associated with it possibly has significant implications for nematode management and crop protection. This study integrates detailed morphological observations with molecular analyses to characterize Aphelenchoides vinhphucensis sp. n., contributing to the taxonomy of the genus and providing insights into its phylogenetic placement. This work also highlights the importance of combining classical taxonomic methods with modern molecular tools to overcome challenges in species identification and improve our understanding of nematode biodiversity.
Materials and methods
Sampling and nematode extraction
Soil and root samples from rice-growing areas in Vinh Phuc province were collected randomly, placed in separate nylon bags, and transported to the laboratory. The decanting and sieving process was used to recover nematodes from soil samples (Nguyen, Reference Nguyen2003). For extracting nematode from the roots, root samples were divided into 0.5 cm pieces and put on a tray using the modified Baermann tray method described by Whitehead and Hemming (Reference Whitehead and Hemming1965).
Morphological characterisation
Light microscopy: Nematodes were killed by immersing them in hot water (60–70°C) for 30 seconds. They were then fixed in TAF solution (8% formalin and 2% triethanolamine in distilled water) for 4–5 days, following the procedure of Courtney et al. (Reference Courtney, Polley and Miller1955). Subsequently, the specimens were dehydrated using the method described by Seinhorst (Reference Seinhorst1959). Finally, a Carl Zeiss Axio Lab.A1 microscope was used for measuring and taking pictures of the nematodes.
Scanning electron microscopy (SEM): Specimens were hydrated in distilled water, dehydrated through a graded ethanol series, critically point dried, and then coated with gold. Observations were made according to the protocol described by Nguyen et al. (Reference Nguyen, Nguyen, Le and Trinh2023a).
Molecular characterisation
Live nematodes were cut into small fragments and put into PCR tubes for DNA extraction. Subsequently, 20 μl of WLB solution, which contained 50 mM KCl, 10 mM Tris pH 8.3, 2.5 mM MgCl2, 0.45% NP-40, and 0.45% Tween-20, was added. After that, the samples were incubated for at least ten minutes at –20°C. Following the addition of 1μl of proteinase K (1.2 mg ml−1), the samples were incubated for one hour at 65°C and then for 10 minutes at 95°C in a PCR machine.
Primers D2A/D3B (5′–ACAAGTACCGTGGGGAAAGTTG–3′/5′–TCGGAAGGAACCAGCTACTA–3′) (Nunn, Reference Nunn1992) and MN18F/Nem_18S_R (5′–CGCGAATRGCTCATTACAACAGC–3′/5′–GGGCGGTATCTGATCGCC–3′) (Bhadury et al., Reference Bhadury, Austen, Bilton, Lambshead, Rogers and Smerdon2006) were used to amplify the D2-D3 regions of the 28S rRNA and the 18S rRNA regions, respectively. The amplification was performed with the following thermal cycling conditions: an initial denaturation at 94°C for 4 minutes, followed by 5 cycles of 94°C for 30 seconds, 56°C for 30 seconds, and 72°C for 2 minutes. This was followed by 45 cycles of 94°C for 30 seconds, 54°C for 30 seconds, and 72°C for 1 minute, with a final extension at 72°C for 10 minutes and a hold at 10°C (Nguyen et al., Reference Nguyen, Nguyen, Le and Trinh2021). Following purification, the PCR products were sent to Macrogen (Korea) for sequencing.
Sequence assembly of the forward and reverse reads was performed using Geneious R11 (www.geneious.com). In the next step, a BLAST search was performed to find closely related sequences from the GenBank database (Altschul et al., Reference Altschul, Madden, Schäffer, Zhang, Zhang, Miller and Lipman1997). Multiple sequence alignments were performed using MUSCLE, followed by Bayesian phylogenetic analysis with the MrBayes 3.2.6 plugin in Geneious R11. MEGA 7 (Kumar et al., Reference Kumar, Stecher and Tamura2016) was used to determine the best-fit models for Bayesian phylogenetic analysis.
Results
Aphelenchoides vinhphucensis sp. n.
(Figures 1 and 2, measurements in Table 1)
Light microscopy and Scanning electron microscopy pictures of Aphelenchoides vinhphucensis sp. n. A, C-I: Female. A: Entire body; C, D: Anterior end; E: Vulva region showing post-uterus sac; F: Vulva region under SEM; G: Lateral field at mid-body; H-I: Tail region. J, B: Entire body of the male; K: Tail region of the males. (Scale bar: A, B: 50 μm; C: 3 μm; D-H, J, K: 10 μm; I: 5 μm).

Drawings of Aphelenchoides vinhphucensis sp. n. A, C–G: Female. A: Entire body; C, D: Anterior end, E: Vulva region showing post-uterus sac; F: Lateral field at mid-body; G: Tail region. B: Entire body of the male; H, I: Tail region of the male. (Scale bar: A, B: 50 μm, C: 3 μm, D-I: 10 μm).

Measurements of Aphelenchoides vienamensis sp. n. from Vietnam and most similar species. All measurements are in μm (except for ratio) and in the form: mean ± s.d. (range)

Female. Body slender, slightly curved ventrally after heat-killing (Figs. 1A and 2A). Cuticle finely annulated. Lip region rounded, separated from body contour (Figs. 1C, D and 2C, D). Amphidial openings rounded (Fig. 2C). Lateral fields with four lines (Figs. 1G and 2F). Stylet slender, 9.6–12.7 μm long, with small stylet knobs. Stylet cone Ca. 40–46% total stylet length. Median bulb well-developed, oval-shaped with distinct internal valve (Fig. 1D, 2D). Pharyngeal gland elongated (53–67 μm), dorsally and laterally overlapping intestine. Nerve ring located posterior to median bulb. Secretory-excretory pore located below level of nerve ring (56%), occasionally at same level (31%) or above (12.5%). Hemizonid located 8–16 μm posterior to secretory-excretory pore. Vagina directed anteriorly (Figs. 1E and 2E). Vulva slightly protruding with transverse vulva slit (Fig. 1E, F). Reproductive system monodelphic with a single anteriorly directed ovary, typically reaching near pharyngeal gland; Ca. 31–45% body length. Spermatheca oval-shaped, often containing sperm. Posterior uterus sac Ca. 5–7 times body width at vulva or Ca. 50–72% vulva-to-anus distance; containing sperm in some individuals (Fig. 1E, 2E). Tail conical, straight or slightly ventrally curved; tail length Ca. 3–4.5 times body width at anus. Tail terminus with one pointed mucro; mucro smooth under LM, but with fine nodular protuberances under SEM (Figs. 1H, I and 2G).
Males: Similar to female. Body curved ventrally (J-shaped) after heat-killing (Figs. 1B and 2B). Tail terminus with one pointed mucro, three pairs of caudal papillae: one pair subventrolateral near cloacal opening, one pair subventrolateral at mid-tail, one pair subventrolateral near tail terminus (Figs. 1J, K and 2H, I).
Diagnosis and relationships
The population of Aphelenchoides vinhphucensis sp. n. from Vinh Phuc is characterized by a female body length of 599 (467–823) μm and a male body length of 529 (436–635) μm. Lateral fields show four lines. The female stylet is slender, measuring 10.9 μm (9.6–12.7 μm) in length, with distinct stylet knobs. The secretory-excretory pore is located mostly posterior to the level of the nerve ring. The PUS is well-developed, occupying 61% (50–72%) of the vulva-to-anus distance or 6.5 (5–9) times the body width at the vulva. The spicules are arcuate, measuring 17.2 μm (13.4–19.8 μm) in length. The male tail bears three pairs of caudal papillae (2 + 2 + 2). The tails of both sexes are conical, with the tail tip featuring a single mucro covered with fine nodules (warts) visible under SEM.
According to Shahina’s (Reference Shahina1996) grouping system, this species belongs to Group 2 (tail with one or sometimes two mucronate structures). Based on a combination of diagnostic features (PUS length >33% vulva–anus distance, single mucro, conoid tail with c′ ≤5, stylet length 10–11.9 μm, four lateral lines, and excretory pore posterior/level with nerve ring), Aphelenchoides vinhphucensis sp. n. is most similar to several species in Group 2, including A. ensete, A. graminis Baranovskaya and Khak, Reference Baranovskaya and Khak1968, A. fuchsi, A. haguei, A. orientalis (here reassigned to Group 2 based on its original description), A. suipingensis Yu, 1985, and A. xui. The new species can be distinguished from these congeners by the following characters:
Females of Aphelenchoides vinhphucensis sp. n. are distinguished from A. ensete by smaller body length (599 μm (467–823) vs 635 μm (558–754)), smaller a value (39 (34–52) vs 48 (37–62)), smaller b value (7.7 (6.4–9.6) vs 11.4 (9.8–13.3)), and smaller stylet length (10.9 μm (9.6–12.7) vs 12.8 μm (12.0–14.0)) (Swart et al., Reference Swart, Bogale and Tiedt2000). Molecular sequence of Aphelenchoides ensete is not available in GenBank.
Females of Aphelenchoides vinhphucensis sp. n. can be differentiated from A. graminis in several morphometric features: body length is larger (599 μm (467–823) vs 471 μm (389–563)), a value is higher (39 (34–52) vs 25.1 (21.4–29)), b value is slightly lower (7.7 (6.4–9.6) vs 8.6 (7.1–10)), and the V value is lower (68% (66–70%) vs 70.5% (67.6–74%). The position of the excretory pore also differs: in Aphelenchoides vinhphucensis sp. n. it is mostly posterior to the nerve ring, while in A. graminis it is usually at or near the level of the metacorpal bulb. The posterior uterus sac is relatively longer in Aphelenchoides vinhphucensis sp. n. (occupying 50–72% of the vulva-to-anus distance or 6.5 (5–9) times body width at vulva) compared to about 3.8 body widths in A. graminis. The tail of Aphelenchoides vinhphucensis sp. n. is longer and more conical (37 μm (30–43) vs 28 μm (23–33)) with a single mucro bearing nodular ornamentation under SEM, while A. graminis has a bluntly conical tail with a ventrally displaced mucro. The 28S sequences of Aphelenchoides vinhphucensis sp. n. are 73.3–76.7% similar (160–184 bp difference) to those of A. graminis (MN747799).
Females of Aphelenchoides vinhphucensis sp. n. differ from A. fuchsi Esmaeili, Heydari, Ziaie, and Gu, Reference Esmaeili, Heydari, Ziaie and Gu2017 in several characteristics: most measurements of Aphelenchoides vinhphucensis sp. n. are larger, including body length (599 μm (467–823) vs 382 μm (332–400)), stylet length (10.9 μm (9.6–12.7) vs 9.2 μm (8.0–10.0)), a value (39 (34–52) vs 28 (25–33)), b value (7.7 (6.4–9.6) vs 6.8 (6.4–7.3)), b′ value (4.4 (3.6–5.5) vs 3.4 (3.0–3.8)), c value (16.3 (13.7–19.1) vs 12.8 (11.8–14.3)), and tail length (37 μm (30–43) vs 30 μm (25–33)). Additionally, the PUS/vulva-to-anus distance ratio is smaller in the Vietnamese population (61% (50–72%) vs 81% (75–90%)) (Esmaeili et al., Reference Esmaeili, Heydari, Ziaie and Gu2017). The 28S sequences of Aphelenchoides vinhphucensis sp. n. are 72.3–77.6% similar (172–208 bp difference) to those of A. fuchsi (KT003987).
Females of Aphelenchoides vinhphucensis sp. n. can be differentiated from A. haguei Maslen, Reference Maslen1979 in the following characteristics: smaller body length (599 μm (467–823) vs 624 μm (560–765)), larger a value (39 (34–52) vs 33 (28–38)), smaller b value (7.7 (6.4–9.6) vs 8.8 (7.6–10.9)), larger c value (16.3 (13.7–19.1) vs 13.0 (10.6–15.8)), smaller c’ value (3.9 (3.1–4.5) vs 4.4 (3.0-5.6)), shorter tail length (30.1–43.1 μm vs 47 μm (42–54), and anteriorly directed vagina vs vagina perpendicular to the body axis in A. haguei (Maslen, Reference Maslen1979). The 28S sequences of Aphelenchoides vinhphucensis sp. n. differ from those of A. haguei (MN747801) by 56 bp (83% similar).
Females of Aphelenchoides vinhphucensis sp. n. can be separated from A. orientalis by having a larger body length (599 μm (467–823) vs 390 μm (350–410)), larger a value (39 (34–52) vs 21.6 (19.7–21.9)), and smaller V value (68 (66–70) vs 71 (69–73)). The secretory-excretory pore of Aphelenchoides vinhphucensis sp. n. is mostly located posterior to the level of the nerve ring, whereas it is positioned above the level of the nerve ring in A. orientalis. Additionally, the ratio of PUS/VBD in the Vietnamese population is larger (6.5 vs approximately 4 times) (Eroshenko, Reference Eroshenko1968). Molecular sequence of A. orientalis is not available in GenBank.
Females of Aphelenchoides vinhphucensis sp. n. differ from A. suipingensis in several morphometric and morphological characters. Aphelenchoides vinhphucensis sp. n. has a smaller body length (599 μm (467–823) vs 868 μm (647–988)), shorter stylet (10.9 μm (9.6–12.7) vs 12.7 μm (11.8–13)), higher a value (39 (34–52) vs 32 (27–38)), smaller b value (7.7 (6.4–9.6) vs 10.5 (7.7–12)), and smaller c value (16.3 (13.7–19.1) vs 18.0 (14.7–21)). The V value is slightly lower in Aphelenchoides vinhphucensis sp. n. (68% (66–70%) vs 70.4% (67.3–72.5%)). Morphologically, Aphelenchoides vinhphucensis sp. n. has the secretory–excretory pore mostly posterior to the nerve ring, whereas in A. suipingensis it is situated just behind the median bulb. The posterior uterine sac is longer in Aphelenchoides vinhphucensis sp. n. (50–72% of vulva–anus distance, 6.5 body widths at vulva) compared with about three body widths in A. suipingensis. Molecular sequence of A. suipingensis is not available in GenBank.
Females of Aphelenchoides vinhphucensis sp. n. are different from A. xui by smaller body length (599 μm (467–823) vs 770 μm (548-882)), larger a value (39 (34–52) vs 31 (26–44)), smaller stylet length (10.9 μm (9.6–12.7) vs 12.3 μm (11.1–13.2)), smaller distance from anterior end to secretory-excretory pore (73 μm (66–84) vs 87 μm (75–100)), larger ratio of PUS/vulva-anus distance (61 (50–72) vs 50 (39–65)) (Wang et al., Reference Wang, Wang, Gu, Wang and Li2013). The 28S sequences of the Vietnamese population are only 71.5–76.6% similar (183–218 bp difference) to those of A. xui (FJ643488). The 18S sequences of the Vietnamese population are 86.9% similar (140 bp difference) to those of A. xui (FJ643487).
Molecular characterisation
Two 18S rRNA sequences of Aphelenchoides vinhphucensis sp. n., each 1571 bp in length, were obtained and found to be 100% identical. In the 18S phylogenetic analysis, the sequences of Aphelenchoides vinhphucensis sp. n. form a distinct clade with maximal posterior probability (1.0 PP), positioned as a sister group to the sequences of Aphelenchoides macronucleatus (FJ235883) with 0.96 PP support (Fig. 3). However, the sequences of Aphelenchoides vinhphucensis sp. n. are 85% similar (134 bp difference) to the sequences of Aphelenchoides macronucleatus (FJ235883).
Bayesian phylogenetic tree of Aphelenchoides species based on the 18S rRNA gene, constructed using the HKY+G substitution model. Posterior probability values are shown at each node. Sequences generated in this study are highlighted in red and bolded.

Two D2-D3 of the 28S rRNA sequences were obtained for Aphelenchoides vinhphucensis sp. n., with lengths ranging from 709 to 774 bp and showing 99.1% similarity to each other. Phylogenetic analysis of the 28S rRNA placed the sequences of Aphelenchoides vinhphucensis sp. n. in a distinct clade with maximal posterior probability (1.0 PP). This clade is clustered as a sister group to A. fragariae (DQ328683). The sequences of Aphelenchoides vinhphucensis sp. n. are 79.5–80.8% similar (125–134 bp difference) to the sequences of A. fragariae (DQ328683). Together, these three sequences form a strongly supported clade (1.0 PP) (Fig. 4).
Bayesian phylogenetic tree of Aphelenchoides species based on D2–D3 regions of the 28S rRNA gene, constructed using the JC69 substitution model. Posterior probability values are indicated at each node. Sequences obtained in this study are highlighted in red and bolded.

Type host and locality
The new species was discovered in the rhizosphere of rice (Oryza sativa L.) in Vinh Phuc Province, Vietnam, at GPS coordinates N: 21°14′57′′, E: 105°33′38′′.
Type material. The holotype female (slide no. VP-7130-1) and paratypes (slide nos. VP-7130-2 to VP-7130-4) are deposited in the Department of Nematology, Institute of Biology, Vietnam Academy of Science and Technology, 18 Hoang Quoc Viet, Nghia Do, Hanoi, Vietnam. ZooBank ID: urn:lsid:zoobank.org:pub:C28D4D15-22FA-494D-8228-BFA4655D2557.
Etymology
The specific epithet vinhphucensis refers to the type locality, Vietnam, where the species was first discovered.
Discussion
The genus Aphelenchoides has been historically challenging to classify due to its morphological similarity among species. The morphological and morphometric analysis in this study revealed that the Vietnamese population exhibited a high degree of similarity to several closely related species within the genus. Specifically, diagnostic features such as the lateral field, stylet length, secretory-excretory pore position, tail shape, and PUS length overlapped significantly with those reported in A. haguei, A. ensete, A. fuchsi, A. orientalis, and A. xui. However, a more comprehensive assessment, considering the combination of all morphological, morphometric, and molecular characters, clearly supports the designation of the Vietnamese population as a new species. Furthermore, the molecular phylogenetic analysis corroborated these findings by placing the Vietnamese population in a distinct clade, separate from its sister species. While the overlapping diagnostic traits might pose challenges in species delineation based solely on morphology, the integration of these features with other data strongly underscores the novelty of this species. This highlights the importance of an integrative approach in nematode taxonomy, combining traditional morphological diagnosis with molecular and ecological evidence to ensure accurate species identification.
Despite the comprehensive nature of this study, some limitations remain. The morphological overlap among Aphelenchoides species and the incomplete molecular data for certain species in the genus pose ongoing challenges for taxonomists. Expanding the genetic database for Aphelenchoides and incorporating additional molecular markers, such as ITS regions or mitochondrial genes, could provide greater phylogenetic resolution and support for species delineation. Additionally, studies on the life cycle, reproductive behaviour, and ecological interactions of Aphelenchoides vinhphucensis sp. n. would further enhance our understanding of its role within the rhizosphere.
Although molecular analysis was able to clearly define Aphelenchoides vinhphucensis sp. n. as a new species, one should exercise caution when utilizing molecular approaches for identifying known species. For instance, the sequences of well-known species Aphelenchoides fragariae (OR691594 and DQ328683) appeared in two distantly separated clades, a pattern also observed in Aphelenchoides fujianensis (MT811981 and OR911526). Such discrepancies highlight potential issues in molecular taxonomy, emphasizing the need for careful interpretation and the use of integrative methods when identifying or describing nematode species.
The addition of Aphelenchoides vinhphucensis sp. n. to the species list in the genus Aphelenchoides contributes to the growing recognition of nematode biodiversity in Vietnam, particularly in agricultural ecosystems. This discovery underscores the need for continued exploration of nematodes associated with economically significant crops like rice. Rice is a staple crop in Vietnam, and the identification of nematodes associated with its cultivation has implications for nematode management and crop protection. While Aphelenchoides vinhphucensis sp. n. has not been confirmed as a plant pathogen, its association with rice underscores the importance of monitoring nematode populations in agricultural ecosystems. Future studies are needed to determine the ecological role and potential economic impact of Aphelenchoides vinhphucensis sp. n., including pathogenicity assays to evaluate its effect on rice and other crops.
Acknowledgements
This research was supported by a fund from the Vietnam Academy of Science and Technology (project code: UQĐTCB.07/24-25).