Skip to main content Accessibility help
×
Home
Hostname: page-component-dc8c957cd-p6nx7 Total loading time: 0.499 Render date: 2022-01-27T12:41:54.123Z Has data issue: true Feature Flags: { "shouldUseShareProductTool": true, "shouldUseHypothesis": true, "isUnsiloEnabled": true, "metricsAbstractViews": false, "figures": true, "newCiteModal": false, "newCitedByModal": true, "newEcommerce": true, "newUsageEvents": true }

Effect of using green fluorescent protein double-stranded RNA as non-target negative control in Nasonia vitripennis RNA interference assays

Subject: Life Science and Biomedicine

Published online by Cambridge University Press:  10 February 2021

Julien Rougeot*
Affiliation:
Laboratory of Entomology, Wageningen University, Droevendaalsesteeg 1, Radix building, Wageningen, 6708PB, The Netherlands
Yidong Wang
Affiliation:
Laboratory of Entomology, Wageningen University, Droevendaalsesteeg 1, Radix building, Wageningen, 6708PB, The Netherlands
Eveline C. Verhulst
Affiliation:
Laboratory of Entomology, Wageningen University, Droevendaalsesteeg 1, Radix building, Wageningen, 6708PB, The Netherlands
*
*Corresponding author: julien.rougeot@wur.nl.

Abstract

RNA interference (RNAi) is a technique used in many insects to study gene function. However, prior research suggests possible off-target effects when using Green Fluorescent Protein (GFP) sequence as a non-target control. We used a transcriptomic approach to study the effect of GFP RNAi (GFP-i) in Nasonia vitripennis, a widely used parasitoid wasp model system. Our study identified 3.4% of total genes being differentially expressed in response to GFP-i. A subset of these genes appears involved in microtubule and sperm functions. In silico analysis identified 17 potential off-targets, of which only one was differentially expressed after GFP-i. We suggest the primary cause for differential expression after GFP-i is the non-specific activation of the RNAi machinery at the injection site, and a potentially disturbed spermatogenesis. Still, we advise that any RNAi study involving the genes deregulated in this study, exercises caution in drawing conclusions and uses a different non-target control.

Type
Research Article
Information
Result type: Novel result
Creative Commons
Creative Common License - CCCreative Common License - BY
This is an Open Access article, distributed under the terms of the Creative Commons Attribution licence (http://creativecommons.org/licenses/by/4.0), which permits unrestricted re-use, distribution and reproduction, provided the original article is properly cited.
Copyright
© Wageningen University, 2021. Published by Cambridge University Press

1. Introduction

Nasonia vitripennis is a widely used parasitoid wasp model system to study major topics such as genetics, development, ecology, and behavior (Beukeboom & Desplan, Reference Beukeboom and Desplan2003; Lynch, Reference Lynch2015). The first sequencing of its genome has been published in 2010 (Werren et al., Reference Werren, Richards, Desjardins, Niehuis, Gadau, Colbourne, Beukeboom, Desplan, Elsik, Grimmelikhuijzen, Kitts, Lynch, Murphy, Oliveira, Smith, Van Zande, Worley, Zdobnov, Aerts and Gibbs2010). Recently the development of new technologies has pushed the model forward. For example, knock out of genes by the CRISPR/Cas9 technology has been reported but has at the moment not been widely used (Li et al., Reference Li, Au, Douglah, Chong, White, Ferree and Akbari2017) due to low survivability of embryos. Therefore, knockdown of genes by RNA interference (RNAi) or by parental RNAi (pRNAi) is still the most popular method to study gene function and maternal transcript provision in N. vitripennis (Dalla Benetta et al., Reference Dalla Benetta, Antoshechkin, Yang, Nguyen, Ferree and Akbari2020; Lynch & Desplan, Reference Lynch and Desplan2006; Wang et al., Reference Wang, Rensink, Fricke, Riddle, Trent, van de Zande and Verhulst2020; Werren et al., Reference Werren, Loehlin and Giebel2009). However, in other Hymenoptera such as the honeybee, RNAi has been reported to have undesirable off-target effects, for example when using GFP dsRNA as a control (Jarosch & Moritz, Reference Jarosch and Moritz2011; Nunes et al., Reference Nunes, Aleixo, Barchuk, Bomtorin, Grozinger and Simoes2013). Here we investigate the potential for off-target effects of using GFP double-strand RNA (dsRNA) as non-target control in N. vitripennis RNAi experiments.

2. Objective

As RNAi has become a widely used technique in N. vitripennis (Lynch, Reference Lynch2015), it is of importance to identify potential pitfalls generated by the technique. Also, with the now affordable cost of RNA-sequencing technologies, RNAi experiments can be coupled with genome-wide transcriptomic analyses. Therefore, identifying the potential off-target effects of RNAi in N. vitripennis will help researchers to design appropriate controls for their experiments and avoid confusing results or following false positive leads. To this aim, we tested the off-target effect of a non-specific RNAi response by comparing the effect of injecting dsRNA against the non-target GFP together with water-injected or uninjected controls at whole transcriptome level.

3. Methods

Second instar male larvae were injected with either GFP dsRNA (GFP-i), water, or were not injected but otherwise treated the same. Each condition was analyzed in triplicate using five males per sample. The treated males were collected approximately five days later at the white pupal stage and RNA was extracted with Quick-RNA Tissue/Insect Kit according to manufacturer’s protocol (ZymoResearch – R2030). Libraries were prepared with a custom protocol and 150 bp paired-end sequencing was achieved on a HiSeqX (Illumina) by Novogene (Novogene, HK company limited). From the fastQ files, read counts per gene were retrieved using GeneCounts quantification method from STAR (Dobin et al., Reference Dobin, Davis, Schlesinger, Drenkow, Zaleski, Jha, Batut, Chaisson and Gingeras2013) version 2.6.1b and the Nvit_psr_1.1 N. vitripennis genome version with RefSeq annotation GCF_009193385.2 as reference. Differential expression analysis was calculated with DESeq2 (Love et al., Reference Love, Huber and Anders2014) version 1.20.0. Gene Ontology analyses were performed using DAVID bioinformatics resources (Huang da et al., Reference Huang da, Sherman and Lempicki2009) version 6.8. For comparison with the Nunes et al. microarray data from honeybee, only genes found affected in at least two experiments were used (Nunes et al., Reference Nunes, Aleixo, Barchuk, Bomtorin, Grozinger and Simoes2013).

Complete detailed description of the methods is available as supplemental material.

4. Results

Full statistics of bioinformatics analysis are presented in Table S1 and show consistent high quality data in all samples. Pearson correlation analysis shows that the samples have a high correlation coefficient and cluster in three different groups but not based on experimental conditions (Figure 1A). Principal component analysis also revealed no apparent clustering of the different samples based on experimental conditions, except for one replicate of uninjected control segregating away on the PC2 (Figure 1B). Altogether, these results suggest few differences between samples.

Figure 1. Analysis of RNA-sequencing sample reproducibility. (A) Heatmap of Pearson correlation coefficient (r) of GFP-i, water-injected, and uninjected samples. (B) Principal component analysis of GFP-i (orange dots), uninjected (blue triangles), and water-injected (green squares) samples.

Differential expression analysis between uninjected and water-injected samples with an adjusted P-value threshold of (P-adj) < 0.05, revealed that only 46 genes are differentially expressed (Table S2). Therefore, we decided to pool these two conditions into one control group. Differential expression analysis between GFP-i and control samples with P-adj < 0.05 revealed 518 differentially expressed genes (DEG), of which 71 have a higher expression and 447 a lower expression (Figure 2 and Table S3). Gene Ontology analysis on these 518 DEGs identified enrichment for “microtubule-based process”, “cytochrome-c oxidase activity” and “oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor”.

Figure 2. Injection of GFP dsRNA induces changes in gene expression when compared with controls. (A) MA plot showing the fold change (log2-transformed) between gene expression in GFP-i and control (uninjected and water-injected combined) samples as a function of the normalized average count between the two conditions (log10-transformed), as calculated with DEseq2. Genes with significantly differential expression (P-adj < 0.05) are showed in black. For GFP-i and control samples, three and six biological replicates were used, respectively. (B) Bar plot quantifying genes found more expressed (log2FC > 0 and P-adj < 0.05) or less expressed (log2FC < 0 and P-adj < 0.05) after differential expression analysis.

To find regions in the N. vitripennis genome with a potential GFP sequence similarity causing the off-target effects, we aligned the GFP sequence used in our experiment against the N. vitripennis genome. Blastn identified 17 hits with an alignment length ranging from 18 to 46 nucleotides and between 78% to 100% identity (Table S4). Aside from LOC100122071, none of these genes aligned gapless for more than 17 nucleotides. Of these 17 genes, only LOC103318004 is differentially expressed in our RNAseq experiments, with a reduced expression in both water-injected and GFP-i samples (log2FC = −0.76 with P-adj = 0.013 and log2FC = −1.03 with P-adj = 0.006 respectively). We also used the Nasonia specific RNAi off-target prediction tool (Davies & Tauber, Reference Davies and Tauber2015) and it did not find any matching 19-mers of GFP sequence.

Finally, we compared our results with microarray data obtained in another Hymenoptera, the honeybee Apis mellifera. Nunes et al. identified 1,416 differentially expressed genes after GFP dsRNA injection across three different experimental conditions, with high variations between samples and only 18 genes differentially expressed in at least two conditions (Nunes et al., Reference Nunes, Aleixo, Barchuk, Bomtorin, Grozinger and Simoes2013). None of these 18 genes were in our N. vitripennis DEG list (Table 1).

Table 1. Comparison between the effect of GFP dsRNA injection in Apis mellifera and Nasonia vitripennis shows that none of the DE genes found in the two A. mellifera studies are differentially expressed in N. vitripennis.

5. Discussions

Comparison of uninjected and water-injected samples did not reveal a major response caused by the injection procedure itself five days before sampling. However, among the 46 DEGs, LOC100117489 (pyrazinamidase/nicotinamidase) and LOC100120201 (vanin-like protein 2) have been previously linked to oxidative stress in Drosophila and human (Balan et al., Reference Balan, Miller, Kaplun, Balan, Chong, Li, Kaplun, VanBerkum, Arking, Freeman, Maiese and Tzivion2008; Bartucci et al., Reference Bartucci, Salvati, Olinga and Boersma2019) and may suggest some level of stress response upon injection.

Our RNAseq experiments revealed that 518 out of 15,430 total genes (3.4%) are differentially expressed in whole pupae in response to GFP-i with P-adj < 0.05. Among the 447 lower expressed genes, 33 are coding for microtubules or microtubule-associated proteins, predicted to control sperm functions. Also, four cytochrome C oxydase subunits show a decrease in expression. In addition to be possible markers of apoptotic stress, cytochrome C oxydases have been linked to sperm differentiation in Drosophila (Arama et al., Reference Arama, Agapite and Steller2003). Finally, LOC103318004, which is predicted to encode a kelch-like protein 10, showed some sequence similarity with the GFP sequence used in this study. However these two sequences aligned on less than 19 nucleotides without gap, which was described as the minimum consensus length for RNAi (Elbashir et al., Reference Elbashir, Lendeckel and Tuschl2001). LOC103318004 homologs have been linked to gamete development in both Drosophila and mice (Hudson & Cooley, Reference Hudson and Cooley2010; Yan et al., Reference Yan, Ma, Burns and Matzuk2004). LOC103318004 is less expressed in GFP-i samples compared to controls, but, surprisingly, also in water-injected samples when compared to uninjected controls. Therefore, it is unclear whether the decrease in expression of this gene is due to injection stress or is a sequence-specific GFP-i effect, or both. As dsRNA was injected in the abdomen, activation of the RNAi response in this region could affect spermatogenesis. Similar observations have been made in female N. vitripennis, which show some reduced fertility after water or dsRNA injection at pupal stage (Geuverink et al., Reference Geuverink, Rensink, Rondeel, Beukeboom, van de Zande and Verhulst2017).

6. Conclusions

Our transcriptomic comparison of GFP non-specific RNAi with water and uninjected controls revealed moderate off-target effects in male N. vitripennis, potentially affecting spermatogenesis. Only in one case we were able to relate this effect to endogenous GFP sequence similarity in N. vitripennis, and this leads us to assume that GFP-i does not cause specific off-target effects, but instead results in a general response to dsRNA. As we injected into the abdomen, close to the reproductive organs, it could additionally lead to reduced fertility in males. It should be noted that our study focuses on only one sex at one developmental time and results may differ under different experimental conditions.

The lack of overlap between DEGs after RNAi activation in Nasonia and honeybees suggests that off-target effects cannot be generalized across Hymenoptera. The specific effects of RNAi activation and off-target effects should be studied on a species-specific basis. According to our results, GFP seems a suitable non-targeting negative control for RNAi experiments in N. vitripennis as it appears to elicit a general non-specific response against dsRNA, and sets a baseline reference for the target-specific knockdown. However, any RNAi study involving the genes we show to be affected in this study should exercise caution in drawing conclusions and may be safer by using a different non-target control.

Author Contributions

Y.W., J.R. and E.C.V. designed the study. Y.W. performed experiments. J.R. analyzed data. J.R. wrote the initial manuscript draft, all authors revised the draft and approved the final version. E.C.V. acquired funding.

Funding Information

Part of the work was funded by the Innovative Research Scheme of the Dutch Research Council (NWO) granted to ECV (016.Vidi.189.099).

Publishing Ethics

The authors confirm that

  1. 1. the manuscript has been submitted only to the journal – it is not under consideration, accepted for publication or in press elsewhere. Manuscripts may be deposited on pre-print servers;

  2. 2. all listed authors know of and agree to the manuscript being submitted to the journal;

  3. 3. the manuscript contains nothing that is abusive, defamatory, fraudulent, illegal, libelous, or obscene.

Conflict of Interest

The authors declare no conflict of interest.

Data Availability

The sequencing data have been submitted to GEO under accession number GSE153268.

Supplementary Materials

To view supplementary material for this article, please visit http://dx.doi.org/10.1017/exp.2020.67.

References

Arama, E., Agapite, J., & Steller, H. (2003). Caspase activity and a specific cytochrome C are required for sperm differentiation in Drosophila. Developmental Cell, 4, 687697. doi: https://doi.org/10.1016/s1534-5807(03)00120-5.CrossRefGoogle Scholar
Balan, V., Miller, G. S., Kaplun, L., Balan, K., Chong, Z. Z., Li, F., Kaplun, A., VanBerkum, M.F., Arking, R., Freeman, D.C., & Maiese, K., Tzivion, G. (2008). Life span extension and neuronal cell protection by Drosophila nicotinamidase. Journal of Biological Chemistry, 283, 2781027819. https://doi.org/10.1074/jbc.M804681200CrossRefGoogle ScholarPubMed
Bartucci, R., Salvati, A., Olinga, P., & Boersma, Y. L. (2019). Vanin 1: its physiological function and role in diseases. International Journal of Molecular Sciences, 20, 3891. https://doi.org/10.3390/ijms20163891.CrossRefGoogle ScholarPubMed
Beukeboom, L., & Desplan, C. (2003). Nasonia. Current Biology, 13, R860. https://doi.org/10.1016/j.cub.2003.10.042.CrossRefGoogle ScholarPubMed
Dalla Benetta, E., Antoshechkin, I., Yang, T., Nguyen, H. Q. M., Ferree, P. M., & Akbari, O. S. (2020). Genome elimination mediated by gene expression from a selfish chromosome. Science Advances, 6, eaaz9808. doi: https://doi.org/10.1126/sciadv.aaz9808.CrossRefGoogle ScholarPubMed
Davies, N. J., & Tauber, E. (2015). WaspAtlas: a Nasonia vitripennis gene database and analysis platform. Database (Oxford), 2015, bav103. https://doi.org/10.1093/database/bav103CrossRefGoogle ScholarPubMed
Dobin, A., Davis, C. A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., Chaisson, M., & Gingeras, T. R. (2013). STAR: ultrafast universal RNA-seq aligner. Bioinformatics, 29, 1521. https://doi.org/10.1093/bioinformatics/bts635CrossRefGoogle ScholarPubMed
Elbashir, S. M., Lendeckel, W., & Tuschl, T. (2001). RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes & Development, 15, 188200. doi: https://doi.org/10.1101/gad.862301.CrossRefGoogle ScholarPubMed
Geuverink, E., Rensink, A. H., Rondeel, I., Beukeboom, L. W., van de Zande, L., & Verhulst, E. C. (2017). Maternal provision of transformer-2 is required for female development and embryo viability in the wasp Nasonia vitripennis. Insect Biochemistry and Molecular Biology, 90, 2333. https://doi.org/10.1016/j.ibmb.2017.09.007.CrossRefGoogle ScholarPubMed
Huang da, W., Sherman, B. T., & Lempicki, R. A. (2009). Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nature Protocols, 4, 4457. doi: https://doi.org/10.1038/nprot.2008.211.CrossRefGoogle ScholarPubMed
Hudson, A. M., & Cooley, L. (2010). Drosophila Kelch functions with Cullin-3 to organize the ring canal actin cytoskeleton. Journal of Cell Biology, 188, 2937. doi: https://doi.org/10.1083/jcb.200909017.CrossRefGoogle ScholarPubMed
Jarosch, A., & Moritz, R. F. A. (2011). RNA interference in honeybees: off-target effects caused by dsRNA. Apidologie, 43, 128138. doi: https://10.1007/s13592-011-0092-y.CrossRefGoogle Scholar
Li, M., Au, L. Y. C., Douglah, D., Chong, A., White, B. J., Ferree, P. M., & Akbari, O. S. (2017). Generation of heritable germline mutations in the jewel wasp Nasonia vitripennis using CRISPR/Cas9. Scientific Reports, 7, 901. doi: https://doi.org/10.1038/s41598-017-00990-3.CrossRefGoogle ScholarPubMed
Love, M. I., Huber, W., & Anders, S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology, 15, 550. doi: https://doi.org/10.1186/s13059-014-0550-8.CrossRefGoogle ScholarPubMed
Lynch, J. A. (2015). The expanding genetic toolbox of the wasp Nasonia vitripennis and its relatives. Genetics, 199, 897904. doi: https://doi.org/10.1534/genetics.112.147512.CrossRefGoogle ScholarPubMed
Lynch, J. A., & Desplan, C. (2006). A method for parental RNA interference in the wasp Nasonia vitripennis. Nature Protocols, 1, 486494. doi: https://doi.org/10.1038/nprot.2006.70.CrossRefGoogle ScholarPubMed
Nunes, F. M., Aleixo, A. C., Barchuk, A. R., Bomtorin, A. D., Grozinger, C. M., & Simoes, Z. L. (2013). Non-target effects of green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) used in honey bee RNA interference (RNAi) assays. Insects, 4, 90103. https://doi.org/10.3390/insects4010090CrossRefGoogle ScholarPubMed
Wang, Y., Rensink, A., Fricke, U., Riddle, M. C., Trent, C., van de Zande, L., & Verhulst, E. C. (2020). Sexually dimorphic traits and male-specific differentiation are actively regulated by Doublesex during specific developmental windows in Nasonia vitripennis. bioRxiv.Google Scholar
Werren, J. H., Loehlin, D. W., & Giebel, J. D. (2009). Larval RNAi in Nasonia (parasitoid wasp). Cold Spring Harbor Protocols, 2009, pdb prot5311. doi: https://doi.org/10.1101/pdb.prot5311.Google Scholar
Werren, J. H., Richards, S., Desjardins, C. A., Niehuis, O., Gadau, J., Colbourne, J. K., Beukeboom, L. W., Desplan, C., Elsik, C. G., Grimmelikhuijzen, C. J. P., Kitts, P., Lynch, J. A., Murphy, T., Oliveira, D. C. S. G., Smith, C. D., Van Zande, L. D., Worley, K. C., Zdobnov, E. M., Aerts, M., … Gibbs, R. A. (2010). Functional and evolutionary insights from the genomes of three parasitoid Nasonia species. Science, 327, 343348. https://doi.org/10.1126/science.1178028CrossRefGoogle ScholarPubMed
Yan, W., Ma, L., Burns, K. H., & Matzuk, M. M. (2004). Haploinsufficiency of kelch-like protein homolog 10 causes infertility in male mice. Proceedings of the National Academy of Sciences of the United States of America, 101, 77937798. doi: https://doi.org/10.1073/pnas.0308025101.CrossRefGoogle ScholarPubMed
Figure 0

Figure 1. Analysis of RNA-sequencing sample reproducibility. (A) Heatmap of Pearson correlation coefficient (r) of GFP-i, water-injected, and uninjected samples. (B) Principal component analysis of GFP-i (orange dots), uninjected (blue triangles), and water-injected (green squares) samples.

Figure 1

Figure 2. Injection of GFP dsRNA induces changes in gene expression when compared with controls. (A) MA plot showing the fold change (log2-transformed) between gene expression in GFP-i and control (uninjected and water-injected combined) samples as a function of the normalized average count between the two conditions (log10-transformed), as calculated with DEseq2. Genes with significantly differential expression (P-adj < 0.05) are showed in black. For GFP-i and control samples, three and six biological replicates were used, respectively. (B) Bar plot quantifying genes found more expressed (log2FC > 0 and P-adj < 0.05) or less expressed (log2FC < 0 and P-adj < 0.05) after differential expression analysis.

Figure 2

Table 1. Comparison between the effect of GFP dsRNA injection in Apis mellifera and Nasonia vitripennis shows that none of the DE genes found in the two A. mellifera studies are differentially expressed in N. vitripennis.

Supplementary material: File

Rougeot et al. supplementary material

Rougeot et al. supplementary material 1

Download Rougeot et al. supplementary material(File)
File 30 KB
Supplementary material: File

Rougeot et al. supplementary material

Rougeot et al. supplementary material 2

Download Rougeot et al. supplementary material(File)
File 11 KB
Supplementary material: File

Rougeot et al. supplementary material

Rougeot et al. supplementary material 3

Download Rougeot et al. supplementary material(File)
File 2 MB
Supplementary material: File

Rougeot et al. supplementary material

Rougeot et al. supplementary material 4

Download Rougeot et al. supplementary material(File)
File 2 MB
Supplementary material: File

Rougeot et al. supplementary material

Rougeot et al. supplementary material 5

Download Rougeot et al. supplementary material(File)
File 13 KB
Reviewing editor:  Michael Nevels University of St Andrews, Biomolecular Sciences Building, Fife, United Kingdom of Great Britain and Northern Ireland, KY16 9ST
This article has been accepted because it is deemed to be scientifically sound, has the correct controls, has appropriate methodology and is statistically valid, and has been sent for additional statistical evaluation and met required revisions.

Review 1: GFP double-strand RNA injection reveals no off-target effect in Nasonia vitripennis

Conflict of interest statement

Reviewer declares none.

Comments

Comments to the Author: Using RNA-Seq, the authors analyzed the potential undesired effects of dsRNA-GFP as a control in RNAi experiments on the Nasonia vitripennis wasp species. Compared to the previous version of the manuscript, there are many improvements, especially with the use of a less stringent p-value that made it possible to perceive a greater number of genes impacted by GFP-i. Overall, I appreciate the current version of the manuscript and I just have a few questions/ suggestions about it.

In the files I received for analysis there are two titles, but I believe that the correct and most appropriate one is: Effect of using Green Fluorescent Protein double-stranded RNA as non-target negative control in Nasonia vitripennis RNA interference assays.

Based on the GFP-primers sequences, the reported dsRNA size (460 bp) and the Emerald GFP CDS sequence, I believe the target fragment used for dsRNA-GFP synthesis is the one below and should be included in the supplementary material:

5 ‘ - GTGACCACCTTGACCTACGGCGTGCAGTGCTTCGCCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAAGGTCTATATCACCGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGACCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGA - 3’

Lines 28-29: replace “for example when using GFP coding sequence as a control” by “for example when using GFP dsRNA as a control”.

The authors did not report in the main text or supplementary material how many micrograms were used to prepare the RNA-Seq libraries (for the enrichment of mRNAs and first strand cDNA synthesis).

Presentation

Overall score 5 out of 5
Is the article written in clear and proper English? (30%)
5 out of 5
Is the data presented in the most useful manner? (40%)
5 out of 5
Does the paper cite relevant and related articles appropriately? (30%)
5 out of 5

Context

Overall score 4.2 out of 5
Does the title suitably represent the article? (25%)
4 out of 5
Does the abstract correctly embody the content of the article? (25%)
4 out of 5
Does the introduction give appropriate context? (25%)
4 out of 5
Is the objective of the experiment clearly defined? (25%)
5 out of 5

Analysis

Overall score 4.2 out of 5
Does the discussion adequately interpret the results presented? (40%)
4 out of 5
Is the conclusion consistent with the results and discussion? (40%)
4 out of 5
Are the limitations of the experiment as well as the contributions of the experiment clearly outlined? (20%)
5 out of 5

Review 2: GFP double-strand RNA injection reveals no off-target effect in Nasonia vitripennis

Conflict of interest statement

Reviewer declares none

Comments

Comments to the Author: This is an excellent contribution to the literature. I suggest it is accepted. The only thing I might add is that if the authors collected phenotypes from their experiemnst then it might be useful to put these in. If not there is no problem- the paper should be published anyway.

Presentation

Overall score 4.4 out of 5
Is the article written in clear and proper English? (30%)
4 out of 5
Is the data presented in the most useful manner? (40%)
5 out of 5
Does the paper cite relevant and related articles appropriately? (30%)
4 out of 5

Context

Overall score 4.5 out of 5
Does the title suitably represent the article? (25%)
5 out of 5
Does the abstract correctly embody the content of the article? (25%)
4 out of 5
Does the introduction give appropriate context? (25%)
4 out of 5
Is the objective of the experiment clearly defined? (25%)
5 out of 5

Analysis

Overall score 5 out of 5
Does the discussion adequately interpret the results presented? (40%)
5 out of 5
Is the conclusion consistent with the results and discussion? (40%)
5 out of 5
Are the limitations of the experiment as well as the contributions of the experiment clearly outlined? (20%)
5 out of 5
You have Access
Open access
1
Cited by

Send article to Kindle

To send this article to your Kindle, first ensure no-reply@cambridge.org is added to your Approved Personal Document E-mail List under your Personal Document Settings on the Manage Your Content and Devices page of your Amazon account. Then enter the ‘name’ part of your Kindle email address below. Find out more about sending to your Kindle. Find out more about sending to your Kindle.

Note you can select to send to either the @free.kindle.com or @kindle.com variations. ‘@free.kindle.com’ emails are free but can only be sent to your device when it is connected to wi-fi. ‘@kindle.com’ emails can be delivered even when you are not connected to wi-fi, but note that service fees apply.

Find out more about the Kindle Personal Document Service.

Effect of using green fluorescent protein double-stranded RNA as non-target negative control in Nasonia vitripennis RNA interference assays
Available formats
×

Send article to Dropbox

To send this article to your Dropbox account, please select one or more formats and confirm that you agree to abide by our usage policies. If this is the first time you use this feature, you will be asked to authorise Cambridge Core to connect with your <service> account. Find out more about sending content to Dropbox.

Effect of using green fluorescent protein double-stranded RNA as non-target negative control in Nasonia vitripennis RNA interference assays
Available formats
×

Send article to Google Drive

To send this article to your Google Drive account, please select one or more formats and confirm that you agree to abide by our usage policies. If this is the first time you use this feature, you will be asked to authorise Cambridge Core to connect with your <service> account. Find out more about sending content to Google Drive.

Effect of using green fluorescent protein double-stranded RNA as non-target negative control in Nasonia vitripennis RNA interference assays
Available formats
×
×

Reply to: Submit a response

Please enter your response.

Your details

Please enter a valid email address.

Conflicting interests

Do you have any conflicting interests? *