Hostname: page-component-76d6cb85b7-kcxw8 Total loading time: 0 Render date: 2026-07-12T13:36:14.207Z Has data issue: false hasContentIssue false

Effect of using green fluorescent protein double-stranded RNA as non-target negative control in Nasonia vitripennis RNA interference assays

Subject: Life Science and Biomedicine

Published online by Cambridge University Press:  10 February 2021

Julien Rougeot*
Affiliation:
Laboratory of Entomology, Wageningen University, Droevendaalsesteeg 1, Radix building, Wageningen, 6708PB, The Netherlands
Yidong Wang
Affiliation:
Laboratory of Entomology, Wageningen University, Droevendaalsesteeg 1, Radix building, Wageningen, 6708PB, The Netherlands
Eveline C. Verhulst
Affiliation:
Laboratory of Entomology, Wageningen University, Droevendaalsesteeg 1, Radix building, Wageningen, 6708PB, The Netherlands
*
*Corresponding author: julien.rougeot@wur.nl.

Abstract

RNA interference (RNAi) is a technique used in many insects to study gene function. However, prior research suggests possible off-target effects when using Green Fluorescent Protein (GFP) sequence as a non-target control. We used a transcriptomic approach to study the effect of GFP RNAi (GFP-i) in Nasonia vitripennis, a widely used parasitoid wasp model system. Our study identified 3.4% of total genes being differentially expressed in response to GFP-i. A subset of these genes appears involved in microtubule and sperm functions. In silico analysis identified 17 potential off-targets, of which only one was differentially expressed after GFP-i. We suggest the primary cause for differential expression after GFP-i is the non-specific activation of the RNAi machinery at the injection site, and a potentially disturbed spermatogenesis. Still, we advise that any RNAi study involving the genes deregulated in this study, exercises caution in drawing conclusions and uses a different non-target control.

Information

Type
Research Article
Information
Result type: Novel result
Creative Commons
Creative Common License - CCCreative Common License - BY
This is an Open Access article, distributed under the terms of the Creative Commons Attribution licence (http://creativecommons.org/licenses/by/4.0), which permits unrestricted re-use, distribution and reproduction, provided the original article is properly cited.
Copyright
© Wageningen University, 2021. Published by Cambridge University Press
Figure 0

Figure 1. Analysis of RNA-sequencing sample reproducibility. (A) Heatmap of Pearson correlation coefficient (r) of GFP-i, water-injected, and uninjected samples. (B) Principal component analysis of GFP-i (orange dots), uninjected (blue triangles), and water-injected (green squares) samples.

Figure 1

Figure 2. Injection of GFP dsRNA induces changes in gene expression when compared with controls. (A) MA plot showing the fold change (log2-transformed) between gene expression in GFP-i and control (uninjected and water-injected combined) samples as a function of the normalized average count between the two conditions (log10-transformed), as calculated with DEseq2. Genes with significantly differential expression (P-adj < 0.05) are showed in black. For GFP-i and control samples, three and six biological replicates were used, respectively. (B) Bar plot quantifying genes found more expressed (log2FC > 0 and P-adj < 0.05) or less expressed (log2FC < 0 and P-adj < 0.05) after differential expression analysis.

Figure 2

Table 1. Comparison between the effect of GFP dsRNA injection in Apis mellifera and Nasonia vitripennis shows that none of the DE genes found in the two A. mellifera studies are differentially expressed in N. vitripennis.

Supplementary material: File

Rougeot et al. supplementary material

Rougeot et al. supplementary material 1

Download Rougeot et al. supplementary material(File)
File 30.3 KB
Supplementary material: File

Rougeot et al. supplementary material

Rougeot et al. supplementary material 2

Download Rougeot et al. supplementary material(File)
File 11.4 KB
Supplementary material: File

Rougeot et al. supplementary material

Rougeot et al. supplementary material 3

Download Rougeot et al. supplementary material(File)
File 1.6 MB
Supplementary material: File

Rougeot et al. supplementary material

Rougeot et al. supplementary material 4

Download Rougeot et al. supplementary material(File)
File 1.6 MB
Supplementary material: File

Rougeot et al. supplementary material

Rougeot et al. supplementary material 5

Download Rougeot et al. supplementary material(File)
File 12.9 KB
Reviewing editor:  Michael Nevels University of St Andrews, Biomolecular Sciences Building, Fife, United Kingdom of Great Britain and Northern Ireland, KY16 9ST
This article has been accepted because it is deemed to be scientifically sound, has the correct controls, has appropriate methodology and is statistically valid, and has been sent for additional statistical evaluation and met required revisions.

Review 1: GFP double-strand RNA injection reveals no off-target effect in Nasonia vitripennis

Conflict of interest statement

Reviewer declares none.

Comments

Comments to the Author: Using RNA-Seq, the authors analyzed the potential undesired effects of dsRNA-GFP as a control in RNAi experiments on the Nasonia vitripennis wasp species. Compared to the previous version of the manuscript, there are many improvements, especially with the use of a less stringent p-value that made it possible to perceive a greater number of genes impacted by GFP-i. Overall, I appreciate the current version of the manuscript and I just have a few questions/ suggestions about it.

In the files I received for analysis there are two titles, but I believe that the correct and most appropriate one is: Effect of using Green Fluorescent Protein double-stranded RNA as non-target negative control in Nasonia vitripennis RNA interference assays.

Based on the GFP-primers sequences, the reported dsRNA size (460 bp) and the Emerald GFP CDS sequence, I believe the target fragment used for dsRNA-GFP synthesis is the one below and should be included in the supplementary material:

5 ‘ - GTGACCACCTTGACCTACGGCGTGCAGTGCTTCGCCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAAGGTCTATATCACCGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGACCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGA - 3’

Lines 28-29: replace “for example when using GFP coding sequence as a control” by “for example when using GFP dsRNA as a control”.

The authors did not report in the main text or supplementary material how many micrograms were used to prepare the RNA-Seq libraries (for the enrichment of mRNAs and first strand cDNA synthesis).

Presentation

Overall score 5 out of 5
Is the article written in clear and proper English? (30%)
5 out of 5
Is the data presented in the most useful manner? (40%)
5 out of 5
Does the paper cite relevant and related articles appropriately? (30%)
5 out of 5

Context

Overall score 4.2 out of 5
Does the title suitably represent the article? (25%)
4 out of 5
Does the abstract correctly embody the content of the article? (25%)
4 out of 5
Does the introduction give appropriate context? (25%)
4 out of 5
Is the objective of the experiment clearly defined? (25%)
5 out of 5

Analysis

Overall score 4.2 out of 5
Does the discussion adequately interpret the results presented? (40%)
4 out of 5
Is the conclusion consistent with the results and discussion? (40%)
4 out of 5
Are the limitations of the experiment as well as the contributions of the experiment clearly outlined? (20%)
5 out of 5

Review 2: GFP double-strand RNA injection reveals no off-target effect in Nasonia vitripennis

Conflict of interest statement

Reviewer declares none

Comments

Comments to the Author: This is an excellent contribution to the literature. I suggest it is accepted. The only thing I might add is that if the authors collected phenotypes from their experiemnst then it might be useful to put these in. If not there is no problem- the paper should be published anyway.

Presentation

Overall score 4.4 out of 5
Is the article written in clear and proper English? (30%)
4 out of 5
Is the data presented in the most useful manner? (40%)
5 out of 5
Does the paper cite relevant and related articles appropriately? (30%)
4 out of 5

Context

Overall score 4.5 out of 5
Does the title suitably represent the article? (25%)
5 out of 5
Does the abstract correctly embody the content of the article? (25%)
4 out of 5
Does the introduction give appropriate context? (25%)
4 out of 5
Is the objective of the experiment clearly defined? (25%)
5 out of 5

Analysis

Overall score 5 out of 5
Does the discussion adequately interpret the results presented? (40%)
5 out of 5
Is the conclusion consistent with the results and discussion? (40%)
5 out of 5
Are the limitations of the experiment as well as the contributions of the experiment clearly outlined? (20%)
5 out of 5