Introduction
Acetolactate synthase (ALS) is a key enzyme that catalyzes the first step in the branched-chain amino acid biosynthesis of valine (Val), leucine (Leu), and isoleucine (Ile) (Dimou et al. Reference Dimou, Tsimihodimos and Bairaktari2022; Zhao et al. Reference Zhao, Meng, Ma, Zhao, An and Xiao2021). ALS-inhibiting herbicides are commonly used in fields to control noxious weeds and mainly consist of five different families: imidazolinones (IMI), sulfonylureas (SU), pyrimidinyl thiobenzoates (PTB), sulfonylamino-carbonyl-triazolinones, and triazolopyrimidines (TP) (Zhao et al. Reference Zhao, Yan, Ge, Zhu, Liu and Wang2019).
ALS-inhibiting herbicides are widely used due to their high efficacy, broad-spectrum weed control, high selectivity, and exceptional safety for humans and livestock (Turra et al. Reference Turra, Cutti, Machado, Dias, Andres, Markus and Merotto2023). However, their extensive and prolonged use has led to the emergence of increasing resistance to ALS inhibitors in weeds. Globally, resistance to ALS-inhibiting herbicides has been documented in 176 weed species, comprising 108 dicotyledons and 68 monocotyledons (Heap Reference Heap2025). Herbicide-resistance mechanisms are primarily categorized into two types: target-site resistance (TSR) and non–target site resistance (NTSR). TSR includes target-site mutations, as well as changes in the expression of target genes (Délye et al. Reference Délye, Jasieniuk and Corre2013). In most cases, ALS target-site mutations are the key cause of herbicide resistance (J Wang et al. Reference Wang, Qi, Ouyang, Zhou, Qin, Zhang, Bai and Pan2024). Mutations in the ALS gene of weed species have been extensively documented, with numerous mutation sites identified across five conserved domains (A to E) (Chtourou et al. Reference Chtourou, Osuna, Vázquez-García, Lozano-Juste, Prado, Torra and Souissi2024; Kaya et al. Reference Kaya, Erken, Zandstra and Menna2022). To date, more than 30 distinct mutation sites have been reported. These mutations primarily include Pro-197 in domain A, Trp-574 in domain B, Ala-122 in domain C, Ala-205 in domain D, and Ser-653 in domain E (Xu et al. Reference Xu, Pan, Wang, Chen, Chen and Zhu2020; Yu and Powles Reference Yu and Powles2014). The first documented case was the Trp-574-Leu mutation discovered in 1993 (Heap Reference Heap2025). These mutations confer varying resistance patterns to different types of ALS inhibitors. The Pro-197 mutation typically confers resistance to SU and IMI, while maintaining susceptibility to TP in common lambsquarters (Chenopodium album L.) (Cao et al. Reference Cao, Zhou, Wei, Huang, Lan, Li, Sun and Huang2022). In contrast, the Trp-574 mutation in barnyardgrass [Echinochloa crus-galli (L.) P. Beauv.] generally confers broad-spectrum resistance to all ALS-inhibiting herbicides (Panozzo et al. Reference Panozzo, Scarabel, Tranel and Sattin2013). The Ala-122 mutation primarily confers resistance to IMI, while the Ser-653 mutation shows specific resistance to IMI and TP (Massa et al. Reference Massa, Krenz and Gerhards2011). Notably, mutation patterns and resistance spectra vary significantly among different weed species and geographic locations (Menchari et al. Reference Menchari, Camilleri, Michel, Brunel, Dessaint, Le Corre and Délye2006).
Italian ryegrass [Lolium perenne L. ssp. multiflorum (Lam.) Husnot] is an annual, biennial, or short-term perennial herb of the grass family that has developed into a persistent weed in wheat (Triticum aestivum L.) fields in China (Wu et al. Reference Wu, Song, Zhang, Zhou, Liu, Jin and Zhao2022). It exhibits widespread distribution across numerous regions and has demonstrated a significant capacity to develop resistance to various herbicides (Bobadilla et al. Reference Bobadilla, Hulting, Berry, Moretti and Mallory-Smith2021). Resistance to glyphosate was initially documented in the United States in 1998, and herbicide-resistant populations of L. perenne ssp. multiflorum have been identified in at least 13 countries to date (Heap Reference Heap2025). The first report of ALS herbicide resistance in L. perenne ssp. multiflorum occurred in Australia in 1982, followed by subsequent reports in Tunisia, Morocco, and other African countries (Heap Reference Heap2025). The mechanism of resistance of L. perenne ssp. multiflorum to ALS-inhibiting herbicides includes TSR and NTSR. Many studies focused on TSR, mainly due to resistance caused by target-site mutations. Tehranchian et al. (Reference Tehranchian, Nandula, Matzrafi and Jasieniuk2019) reported the substitution of Trp-574-Leu and Asp-376-Glu in the ALS gene in L. perenne ssp. multiflorum populations resistant to an ALS-inhibiting herbicide. Wu et al. (Reference Wu, Song, Zhang, Zhou, Liu, Jin and Zhao2022) found that the mechanism of target resistance of L. perenne ssp. multiflorum to ALS inhibitors of SU was related to the mutation of proline at position 197 of the ALS gene. Zhu et al. (Reference Zhu, Wang, Gao, Liu, Li, Feng and Dong2023) found that the mutation of proline at position 197 to threonine or glutamine and the mutation of tryptophan to leucine at position 574 in ALS of L. perenne ssp. multiflorum would make it resistant to pyroxsulam. However, it remains unclear whether different mutation types in the ALS gene of L. perenne ssp. multiflorum confer varying levels of herbicide resistance and what the nature of these differences might be.
The rapid and accurate detection of resistant weeds is crucial for implementing timely and effective weed management strategies. Currently, several rapid detection methods have been developed, including allele-specific PCR (Kadaru et al. Reference Kadaru, Zhang, Yadav and Oard2008; Zhang et al. Reference Zhang, Ban, Wei, Wu, Dong and Feng2025), quantitative PCR (qPCR) (Dongo et al. Reference Dongo, Leflon, Simier and Delavault2012), and clustered regularly interspaced short palindromic repeats–based detection systems (Ban et al. Reference Ban, Zhang, Wei, Xu, Ma, Yin, Dong and Feng2025). The derived cleaved amplified polymorphic sequences (dCAPS) method, first developed by Neff et al. (Reference Neff, Neff and Chory1998), has emerged as a particularly valuable tool. The dCAPS method creates a restriction enzyme recognition site by introducing one or more mismatched bases into specific primers. Based on differences in fragment lengths after enzymatic digestion, it allows for accurate genotyping of samples. This method is characterized by its simple operation, intuitive results, short processing time, and low cost, making it suitable for detecting high-throughput samples (Yin et al. Reference Yin, Wang, Liao, Cao and Zhao2024). Currently, dCAPS can be used to analyze the genetic diversity of plant populations, study evolutionary relationships, and investigate gene functions, including identifying single-nucleotide polymorphisms associated with specific traits (Huang et al. Reference Huang, Long, Mao, Wang, Liu, Li and Jing2020; Wang et al. Reference Wang, Xu, Chang, Hao, Li and Jing2018). Using the dCAPS method to detect mutations conferring target site–mediated herbicide resistance in weeds can be used to recommend alternative herbicides and thus to significantly reduce the occurrence of resistant weeds in the field and mitigate their impact on agricultural production. However, there have been no reports on rapid detection methods for ALS gene mutations in L. perenne ssp. multiflorum to date.
Therefore, the objectives of this study were (1) to develop a rapid detection method for ALS gene mutations in L. perenne ssp. multiflorum, utilizing this method to purify and isolate resistant populations; and (2) to evaluate the resistance differences between populations with different mutation types at one ALS locus.
Materials and Methods
Plants, Herbicides, and Chemicals
In 2020, the herbicide-resistant population of L. perenne ssp. multiflorum (designated as R) was collected from a wheat field in Zhumadian, Henan, China (32.97°N, 114.03°E). The field has a long-term history of using ALS-inhibiting herbicides, acetyl-CoA carboxylase (ACCase)-inhibiting herbicides, and photosystem (PSII)-inhibiting herbicides, and the L. perenne ssp. multiflorum population had evolved multiple resistance to herbicides from different modes of action (Zhu et al. Reference Zhu, Wang, Gao, Liu, Li, Feng and Dong2023). In contrast, seeds of the herbicide-sensitive population (designated as S) were collected from a recreational site in Jiangsu, China (32.05°N, 118.80°E), which had no history of herbicide use. Of each population, seeds were manually harvested from more than 50 mature plants, subsequently dried for 7 d, and stored at 4 C for preservation.
Pyroxsulam (7.5%, wettable dispersible granules (WG)) was provided by Corteva Agrisciences, Beijing, China; mesosulfuron-methyl was provided by Bayer Crop Sciences (30 g L−1, Oil miscibleflowableconcentrate (OF)), Hangzhou, China; fenoxaprop-P-ethyl (69 g L−1, emulsifiable concentrate (EW)) was provided by Bayer Crop Sciences, Hangzhou, China; isoproturon (50%, wettable powder (WP)), Jiangsu Futian Agrochemical, China; cypyrafluone (6%, Suspension Concentrate (SC)), KingAgroot, Qingdao, China. The cytochrome P450 (P450) inhibitor piperonyl butoxide (PBO, 95%) was purchased from Aladdin (Shanghai, China, CAS#51-03-6).
Characterization and Purification of Individual Lolium perenne ssp. multiflorum with Distinct Mutations
Seeds from the herbicide-resistant L. perenne ssp. multiflorum population with confirmed ALS gene mutations (Zhu et al. Reference Zhu, Wang, Gao, Liu, Li, Feng and Dong2023) were cultivated in 7 cm by 7 cm by 7 cm plastic pots with drainage holes at the bottom that were filled with a standardized soil mixture (organic substrate and sandy soil with a 1:2 w/w ratio, pH = 6.2). Each pot was sown with 20 seeds, which were later thinned to 10 uniform seedlings; there were 4 replicate pots in total. The plants were maintained in controlled greenhouse conditions with a 12-h photoperiod, a diurnal temperature regime of 20/15 C (day/night), a light intensity of 120 µmol m−2 s−1, and relative humidity of 65%. At the 3- to 4-leaf stage, leaf tissue samples of the resistant L. perenne ssp. multiflorum population were collected for genomic DNA extraction. Mutant genotypes were identified using the dCAPS method, and homozygous mutant individuals were selected and labeled for subsequent analysis. Upon reaching the 5- to 6-leaf stage, individual plants were transplanted into larger pots (20 cm diameter × 20 cm height) for isolated outdoor cultivation. The growth cycle extended from October to June of the following year, with physical isolation measures implemented to prevent pollen contamination. Homozygous Pro-197-Gln (RR) plants underwent two rounds of purification (Figure 1). The susceptible S population did not require further purification.
Separation and purification of different Lolium perenne ssp. multiflorum resistant populations from China.

dCAPS Markers
DNA Isolation
The plant growth conditions are as described earlier; 100 mg of young shoot tissues at the 3- to 4-leaf stage of individual plants of S and R populations were collected and ground with liquid nitrogen. Genomic DNA was isolated using a commercial plant genomic DNA extraction kit (Tiangen Biotechnology, Beijing, China) in accordance with the manufacturer’s instructions.
PCR Amplification and Mutation Detection
The dCAPS Finder 2.0 (http://helix.wustl.edu/dcaps/dcaps.html) was employed to design specific primers for detecting mutations at the Pro-197 position. Initial screening primers were designed to identify potential mutations, followed by the development of mutation-specific primers based on the screening results. For the detection of the Pro-197-Thr mutation, a modified reverse primer incorporating a mismatched base (A) was designed to create a MluI restriction site. This design enabled differentiation of genotypes through restriction fragment analysis: (1) samples with the sensitive Pro-197 genotype produced an uncut 211-bp fragment; (2) homozygous resistant Pro-197-Thr genotypes yielded 181-bp and 30-bp fragments after MluI digestion; and (3) heterozygous samples displayed all three fragments (211 bp, 181 bp, and 30 bp). The same dCAPS approach was applied to design primers for the Pro-197-Gln mutation and Pro-197 genotype, with detailed primer information provided in Tables 1 and 2.
Restriction enzymes for derived cleaved amplified polymorphic sequence (dCAPS) assay.

Derived cleaved amplified polymorphic sequence (dCAPS) primers.

a The introduced mismatched bases are underlined.
PCR was performed in a final volume of 25 μl containing 300 ng of DNA, 1 μl of each primer (10 μM), 12.5 μl 2× PCR TaqMix (Vazyme Biotech, Nanjing, China), and 9.5 μl ddH2O. The cycling program consisted of 95 C for 3 min, followed by 35 cycles of 30 s at 95 C, 30 s at annealing temperature (shown in Table 2), and 15 s at 72 C, with a final extension step of 5 min at 72 C. The PCR products were purified according to the manufacturer’s instructions (EasyPure® PCR Purification Kit, TransGen Biotech, Beijing, China). The restriction digestion reaction was performed in a final volume of 20 µl, containing 0.4 µl [2 U] of restriction enzyme (New England Biolabs, MA. USA), 2 µl of 10× NEB buffer, and 0.4 µg of PCR product, with the remaining volume adjusted to 20 µl using ddH2O. The reaction mixture was gently mixed by slow pipetting followed by centrifugation. The digestion was then carried out at 37 C for 30 min. After the digestion reaction was completed, 10 µl of the digestion product was loaded onto a 3% agarose gel stained with ethidium bromide and electrophoresed at 120 V for 40 min. A 2,000-bp DNA marker was used, and the resulting bands were visualized using a gel imaging system. The whole experiment was repeated twice.
Whole-Plant Dose–Response Assay
Resistance of Different Lolium perenne ssp. multiflorum Populations to Pyroxsulam
To evaluate the pyroxsulam resistance in the populations, whole-plant dose–response assays were conducted. Square plastic pots (7 cm by 7 cm by 7 cm, with drainage holes) were prepared with a growth medium composed of sandy soil and organic substrate (2:1 ratio, pH 6.2). Each pot was sown with 20 seeds, which were later thinned to 10 uniform seedlings at the 2- to 3-leaf stage to ensure consistent competition. At the 3- to 4-leaf stage, herbicide application was performed using a precision spray system (3WP-2000, Nanjing Institute of Agricultural Mechanization, Nanjing, China) calibrated to deliver 280 L ha−1 at 230 kPa. The S population was treated with pyroxsulam (recommended dose = 14 g ai ha−1) at eight concentrations (0.11, 0.22, 0.44, 0.88, 1.75, 3.5, 7, and 14 g ai ha−1), while the resistant R population received seven higher doses (3.5, 7, 14, 28, 56, 112, and 224 g ai ha−1). Following treatment, plants were returned to the greenhouse and irrigated as needed. After 21 d, aboveground biomass was harvested, and fresh weight was recorded. Growth reduction (GR) values were calculated using nonlinear regression analysis. The experiment followed a randomized complete block design with three replicates. Once the experiment was completed, one more repeat was conducted.
Cross-Resistance and Multiple Resistance Patterns of Different Lolium perenne ssp. multiflorum Populations to Herbicides
The resistance of S and R populations to herbicides from different mechanisms of action was evaluated through whole-plant bioassays. Four classes of herbicides were tested, including an ALS inhibitor (mesosulfuron-methyl), an ACCase inhibitor (fenoxaprop-P-ethyl), a PSII inhibitor (isoproturon), and a 4-hydroxyphenylpyruvate dioxygenase (HPPD) inhibitor (cypyrafluone). The treatment dosages of herbicides are shown in Table 3. Herbicide application was performed according to the protocol outlined earlier. The aboveground fresh weight was measured at 21 d after treatment to calculate the fresh weight inhibition rate and GR values. The experiment was conducted in duplicate, with each treatment including three biological replicates.
Herbicide dosage for cross-resistance and multiple resistance.

a R, resistant; S, susceptible.
The Effects of PBO on the Resistance of Different Lolium perenne ssp. multiflorum Populations to Pyroxsulam
The plant growth conditions followed the protocol detailed earlier. Upon reaching the target growth stage (3 to 4 leaves), L. perenne ssp. multiflorum populations received an initial treatment with the P450 inhibitor PBO at 4,200 g ai ha−1 (Liu et al. Reference Liu, Shi, Gao, Yin, Dong and Feng2024). The PBO application was performed using a spray system (3WP-2000, Nanjing Institute of Agricultural Mechanization, Nanjing, China). At 1-h after PBO application, pyroxsulam was applied at predetermined concentrations. All treated plants were then maintained under controlled greenhouse conditions. Plant response to treatments was evaluated at 21 d after application by measuring shoot fresh biomass. To verify experimental consistency, the complete trial was repeated under identical growing conditions.
ALS Enzymatic Activity in Different Lolium perenne ssp. multiflorum Populations
ALS enzymatic activity was detected according to previously described methods (Fang et al. Reference Fang, Yang, Zhao, Chen and Dong2022; Liu et al. Reference Liu, Shi, Gao, Yin, Dong and Feng2024), with some modifications. Lolium perenne ssp. multiflorum populations were cultivated in a growth chamber under controlled conditions (20/15 C, 12/12 h, 65% humidity) until they reached the 3- to 4-leaf stage. Then, 3 g of fresh tissue was collected from each sample. The leaf tissue was ground to a fine powder in liquid nitrogen using a mortar and pestle. The powdered sample was immediately transferred to a prechilled beaker, and precooled ALS extraction buffer (0.5 mM MgCl2, 0.5 mM thiamine pyrophosphate [TPP], 10 μM flavin adenine dinucleotide [FAD], 10 mM sodium pyruvate, 1 mM d,l-dithiothreitol [DTT], 1 mM phenyl methane sulfonyl fluoride, 5 g L−1 polyvinyl pyrrolidone, 10% glycerol (v/v), 0.1 M K2HPO4-KH2PO4 phosphate buffer with pH = 7.5) was added. The mixture was allowed to stand on ice for 10 min. The plant residue was removed by filtration, and the filtrate was transferred to a prechilled 50-ml Beckman centrifuge tube. The sample was centrifuged at 27000 × g for 15 min at 4 C. A saturated ammonium sulfate solution was slowly added to the supernatant to achieve a final concentration of 50%, and the mixture was gently stirred until protein precipitation was observed. The solution was centrifuged again at 27,000 × g for 12 min at 4 C. The pellet was resuspended in ALS assay buffer and stored at −20 C until further analysis.
The reaction mixture consisted of 100 μl of enzyme extract, 200 μl of assay buffer (containing 100 mM potassium phosphate buffer [pH 7.5], 200 mM sodium pyruvate, 20 mM MgCl2, 2 mM TPP, 20 μM FAD, and 1 mM DTT), and 100 μl of pyroxsulam at final concentrations of 0, 0.005, 0.05, 0.5, 5, or 50 μM. The mixture was incubated at 37 C in the dark for 60 min to produce acetate; 8 μl of 6 N H2SO4 was added to terminate the reaction. The mixture was subsequently incubated at 60 C for 30 min to convert acetolactate to acetoin. Subsequently, 100 μl of 0.55% (w/w) creatine solution and 100 μl of 5.5% (v/v) α-naphthol in 5 N NaOH were added. ALS enzyme activity was determined by measuring the absorbance of the acetoin-creatine-naphthol complex at 530 nm. Two independent enzyme extractions were performed, and each herbicide concentration was assayed in triplicate.
ALS Gene Expression in Different Populations
ALS gene expression in R and S populations was determined by real-time quantitative PCR (RT-qPCR). As described earlier, L. perenne ssp. multiflorum plants were grown until the 3- to 4-leaf stage, followed by foliar application of pyroxsulam at the recommended field rate (14 g ai ha−1). Leaf tissues were harvested at 0 h (without pyroxsulam treatment), 12 h, 24 h, 3 d, and 5 d after treatment, flash-frozen in liquid nitrogen, and stored at −80 C until RNA extraction. Total RNA was isolated using the RNA extraction reagent (Pudi Biotech, Shanghai, China), and its concentration and purity were assessed with a spectrophotometer (ND-100C, MIULAB, Hangzhou, China). Genomic DNA was removed, and first-strand cDNA was synthesized from 1,000 ng of total RNA using HiScript® II Q RT SuperMix (+gDNA wiper, Vazyme, China).
The ALS gene was amplified using specific primers (ALS/F: GCGATCAAGAAGATGCTTGAGAC; ALS/R: TCCTGCCATCACCTTCCATGAT), designed with Primer3 (http://bioinfo.ut.ee/primer3-0.4.0/). Real-time qPCR was conducted on a QuantStudio 1 system (Thermo Fisher Scientific, MA, USA), with the Ras family GTPase (RGTP) gene as the internal control (Gaines et al. Reference Gaines, Lorentz, Figge, Herrmann, Maiwald, Ott, Han, Busi, Yu, Powles and Beffa2014).
Data Analysis
Statistical analysis of all dose–response measurements was performed using one-way ANOVA in SPSS v. 21 (IBM, Chicago, IL, USA). No significant trial by treatment interactions were observed in the whole-plant bioassay (P > 0.05). The dose–response relationships for whole-plant experiments were analyzed using a four-parameter nonlinear log-logistic model (Equation 1) through SigmaPlot v. 15.0 (Systat Software, Chicago, IL, USA). This analysis enabled the quantification of herbicide concentrations required for 50% growth reduction (GR50) based on fresh weight measurements, as well as the concentrations needed to suppress 50% of ALS enzyme activity (IC50) in the biochemical assays (Fang et al. Reference Fang, Yang, Zhao, Chen and Dong2022).
where y represents fresh weight, expressed as percentage of the untreated control at herbicide dose x; b is the slope; c is the lower limit; d is the upper limit; and g corresponds to GR50 or IC50. The RI was calculated by dividing the GR50 (or IC50) of the resistant (R) population by that of the susceptible (S) population (RI > 2 indicates herbicide resistance) (H Wang et al. Reference Wang, Fang, Li, Sun, Gao, Ren, Liu, Feng and Dong2024). Relative gene expression was calculated using the ΔΔCT method (Livak and Schmittgen Reference Livak and Schmittgen2001), with three biological replicates per treatment and two independent experimental runs.
Results and Discussion
dCAPS Markers for Mutation Purification in Lolium perenne ssp. multiflorum
Two novel dCAPS markers were developed to detect specific mutations in the ALS gene (Pro-197-Thr and Pro-197-Gln) (Table 2). The Pro-197-Thr mutation was specifically identified using the restriction endonuclease MluI. In the absence of mutation, the amplified DNA fragment remains intact, resulting in a single band of 211 bp. Homozygous mutations result in two fragments of 181 bp and 30 bp, whereas heterozygous mutations produce three bands corresponding to 211 bp, 181 bp, and 30 bp, as shown in Figure 2A. The Pro-197-Gln mutation was detected using the restriction enzyme BsgI. Wild-type alleles produced a single undigested band of 175 bp, whereas mutant alleles yielded a detectable 127-bp fragment and an undetectable 48-bp band. In the case of heterozygous ALS loci, three distinct bands of 175 bp, 127 bp, and 48 bp were observed (Figure 2B).
Derived cleaved amplified polymorphic sequence (dCAPS) markers for detecting the Lolium perenne ssp. multiflorum ALS mutations at position 197. (A) MluI digestion pattern of the dCAPS marker for the Pro-197-Thr mutation. (B) BsgI digestion pattern of the dCAPS marker for the Pro-197-Gln mutation. R, resistant; S, susceptible.

Currently, dCAPS detection methods for mutations in the TSR genes of ALS-inhibiting herbicides have been developed for many weed species, such as Chinese sprangletop [Leptochloa chinensis (L.) Nees] and shortawn foxtail (Alopecurus aequalis Sobol.) (Délye and Boucansaud Reference Délye and Boucansaud2008; Giacomini et al. Reference Giacomini, Umphres, Nie, Mueller, Steckel, Young, Scott and Tranel2017; Jiang et al. Reference Jiang, Chen, He, Hu, Zhao, Liao and Cao2025; Yin et al. Reference Yin, Wang, Liao, Cao and Zhao2024). However, such methods have not yet been fully established for L. perenne ssp. multiflorum. In this study, for the first time, a dCAPS-based rapid detection method was developed for target-site mutations; the method enables rapid and accurate detection of single-target mutations at position 197 in the ALS gene of L. perenne ssp. multiflorum.
Whole-Plant Dose–Response Assays
Sensitivity to Pyroxsulam
As shown in Table 4, the Pro-197-Thr population and Pro-197-Gln population isolated from the same R population had significantly higher resistance to pyroxsulam than the S population. At the same time, the GR50 (the herbicide concentration required for 50% growth reduction) value of the Pro-197-Thr population was significantly higher than that of the Pro-197-Gln population. The RI of the Pro-197-Thr population was 508.92, while the RI of the Pro-197-Gln population was 9.75. This indicates that the Pro-197-Thr population exhibited a much higher resistance to pyroxsulam, being 51.20 times more resistant than the Pro-197-Gln population.
Sensitivities of different Lolium perenne ssp. multiflorum populations to pyroxsulam with/without cytochrome P450 metabolic inhibitors.

a GR50 is the effective dose of herbicide causing 50% inhibition of fresh weight and is expressed as grams of active ingredient per hectare (g ai ha−1). A different letter in the column indicates significant differences (P < 0.05).
b RI is the relative tolerance index, ratio of GR50 values relative to the susceptible L. perenne ssp. multiflorum population (S) + PBO at the same treatment.
c ri is the relative tolerance index, ratio of R + PBO populations GR50 values relative to the S + PBO treatment at the same treatment.
d PBO, piperonyl butoxide; 4,200 g ai ha−1 applied 1 h before herbicide application.
Mutations in the ALS gene confer resistance to weeds, and different mutations can result in varying degrees of resistance (Yu et al. Reference Yu, Han and Powles2008). Deng et al. (Reference Deng, Yang, Zhang, Jiao, Mei, Li and Zheng2017) found that flixweed [Descurainia sophia (L.) Webb ex Prantl] populations with Pro-197-Thr and Trp-574-Leu mutations in the ALS gene exhibited resistance to SU herbicides, as well as to IMI and PTB herbicides. Massa et al. (Reference Massa, Krenz and Gerhards2011) reported that silky windgrass [Apera spica-venti (L.) P. Beauv.] populations with Trp-574-Leu and Arg-377-His mutations in the ALS gene showed higher resistance to SU and TP herbicides compared with populations with Pro-197-Thr and Pro-197-Asn mutations. However, these studies did not clarify which type of mutation confers a higher degree of resistance, because they did not compare the differences in resistance levels caused by different amino acid mutations at the same site. In our study, the same population of L. perenne ssp. multiflorum was found to have two different amino acid substitutions at position 197, both of which confer resistance to pyroxsulam (Table 4). However, the Pro-197-Thr population was more resistant to pyroxsulam than the Pro-197-Gln population. This suggests that the substitution of threonine for proline at site 197 has a greater effect on the resistance level of L. perenne ssp. multiflorum than substitution of glutamine.
Sensitivity to Other Herbicides
We further investigated the resistance levels of different mutant types of L. perenne ssp. multiflorum populations to herbicides with different modes of action. The results showed that the Pro-197-Thr and Pro-197-Gln populations exhibited varying degrees of resistance to ALS inhibitors (Table 5). The Pro-197-Thr population showed a higher resistance level to mesosulfuron-methyl, with an RI value of 35.0, compared with the Pro-197-Gln population, which had an RI value of 7.9. However, there was little difference in resistance levels between the Pro-197-Thr and Pro-197-Gln populations to herbicides with other modes of action (Table 5). For the ACCase inhibitor fenoxaprop-P-ethyl, the Pro-197-Thr population had an RI value of 4.6, while the Pro-197-Gln population had an RI value of 3.9, both indicating a certain level of resistance, but the difference between the two populations was minimal. For the PSII inhibitor isoproturon and HPPD inhibitor cypyrafluone, both the Pro-197-Thr and Pro-197-Gln populations remained sensitive (Table 5).
Sensitivities of different Lolium perenne ssp. multiflorum populations to herbicides.a

a ACCase: acetyl-coA carboxylase; ALS, acetolactate synthase; HPPD: 4-hydroxyphenylpyruvate dioxygenase; PSII: photosystem II complex.
b GR50 is the effective dose of herbicide causing 50% inhibition of fresh weight and is expressed as grams of active ingredient per hectare (g ai ha−1). A different letter in the column indicates significant differences (P < 0.05).
c RI is the relative tolerance index, ratio of GR50 values relative to the susceptible L. perenne ssp. multiflorum population (S) at the same treatment.
Amino acid substitution at different sites of ALS gene can cause weeds to evolve resistance to different herbicides with same mode of action (Powles and Yu Reference Powles and Yu2010; Yu and Powles Reference Yu and Powles2014). For example, Merriam et al. (Reference Merriam, Malone, Hereward, Gill and Preston2023) found that different amino acid substitution populations at ALS gene 197 have been shown to confer cross-resistance to SU and IMI herbicides in prickly lettuce (Lactuca serriola L.). In the cross-resistance experiments of our study, the Pro-197-Thr and Pro-197-Gln populations showed significant resistance to mesosulfuron-methyl, with the Pro-197-Thr population displaying a higher level of resistance (Table 5).
In Vitro ALS Enzymatic Activity between Lolium perenne ssp. multiflorum Populations with Different Mutations
Through in vitro determination of the sensitivity of ALS enzyme to pyroxsulam, it was found that the Pro-197-Thr and Pro-197-Gln populations exhibited significantly lower sensitivity to pyroxsulam compared with the S population (Figure 3). The Pro-197-Thr population showed significantly lower sensitivity to pyroxsulam than the Pro-197-Gln population. The IC50 (the herbicide concentration required for 50% inhibition of enzymatic activity) value for the S population was 7.06 nM, while the IC50 values for the Pro-197-Thr and Pro-197-Gln populations were 1,172.17 nM and 757.12 nM, respectively (Table 6). The IC50 value for the Pro-197-Thr population was 415.05 nM higher than that of the Pro-197-Gln population. This result is consistent with the whole-plant bioassay (Table 4), indicating that the Pro-197-Thr population has lower sensitivity to pyroxsulam.
Inhibition of in vitro ALS enzyme activities of different Lolium perenne ssp. multiflorum populations upon treatment with pyroxsulam.

In vitro ALS enzymatic activities of different Lolium perenne ssp. multiflorum populations upon treatment with pyroxsulam

a IC50 is the effective dose of herbicide causing 50% inhibition of ALS enzymatic activity.
Different letters indicate significant differences (P < 0.05).
The change in in vitro ALS enzymatic activity is a key factor in the development of herbicide resistance in weeds. Cao et al. (Reference Cao, Zhou, Wei, Huang, Lan, Li, Sun and Huang2022) found that the ALS enzyme activity in two resistant populations of C. album was 17.1- and 19.3-fold higher than that of the sensitive population. Sun et al. (Reference Sun, Niu, He, Yu, Chen, Cui and Li2024) demonstrated that the IC50 value of ALS enzyme activity in a resistant E. crus-galli population was 4.12 times higher than that of the sensitive population, which is the reason for the resistance of these populations to penoxsulam. Our study yielded analogous results, the heightened resistance level of the Pro-197-Thr population to pyroxsulam compared with the Pro-197-Gln population may be attributed to a reduced sensitivity of the ALS enzyme to pyroxsulam.
ALS Gene Expression in Populations with Different Mutations
The expression levels of the ALS gene in different populations were monitored at four time points after treatment with pyroxsulam (the untreated samples of 0 h were used to normalize gene expression) (Figure 4). The results indicated that the expression levels of ALS gene in the S population or the Pro-197-Gln population did not show significant changes after herbicide treatment, and no significant differences were observed among the different time points. However, the expression of the ALS gene in the Pro-197-Thr population was upregulated following pyroxsulam treatment, peaking at 5 d and showing significantly higher levels compared with the Pro-197-Gln subpopulation, which was 2.68 times that of the Pro-197-Gln subpopulation. Under pyroxsulam treatment, the ALS gene expression level in the Pro-197-Thr population was higher than that in the S population and the Pro-197-Gln population. However, there was no significant difference in ALS gene expression between the Pro-197-Gln population and the S population (Figure 4). The increased expression of target genes may also contribute to herbicide resistance (Gaines et al. Reference Gaines, Zhang, Wang, Bukun, Chisholm, Shaner and Westra2010; Singh et al. Reference Singh, Singh, Lawton-Rauh, Bagavathiannan and Roma-Burgos2018). In this study, the ALS gene exhibited higher expression levels in the Pro-197-Thr population compared with the Pro-197-Gln population following herbicide treatment. This upregulation could lead to increased accumulation of ALS enzyme, potentially influencing resistance levels (Tanigaki et al. Reference Tanigaki, Uchino, Okawa, Miura, Hamamura, Matsuo, Yoshino, Ueno, Toyama, Fukumi, Kijima, Masuda, Shimono, Tominaga and Iwakami2021). This mechanism aligns with previous findings, suggesting that elevated target gene expression is a common strategy for herbicide resistance in weeds. For instance, Yu et al. (Reference Yu, McCullough, McElroy, Jespersen and Shilling2020) found that in annual sedge (Cyperus compressus L.), the expression levels of the ALS gene in two resistant populations were 5.2 times and 3.6 times higher, respectively, compared with the susceptible population. Elevated gene expression may therefore be an important factor in enhancing herbicide tolerance.
Relative mRNA level of ALS gene in different Lolium perenne ssp. multiflorum populations with or without pyroxsulam treatment. Lowercase letters indicate comparisons between different time points within the same population, while uppercase letters denote comparisons between different populations at the same time point. ANOVA significance is shown with different letters, P < 0.05. Data are derived from at least three biological replicates.

Sensitivity of Populations to Pyroxsulam upon Treatment with PBO
The RI value of the S population to pyroxsulam did not change significantly after the application of P450 inhibitor PBO (Table 4). However, the RI value of the R population showed significant changes, the RI value of the Pro-197-Thr population decreased from 508.92 to 159.84, indicating that the resistance to pyroxsulam remained high. The RI decrease (∼3.2-fold in Thr and ∼4.7-fold in Gln) suggests a P450-based resistance in both populations. However, the Pro-197-Thr population still had stronger resistance after PBO treatment. Therefore, the mutation of the ALS gene at position 197 in L. perenne ssp. multiflorum, where proline is replaced by threonine, confers a higher resistance to pyroxsulam compared with the mutation where proline is replaced by glutamine. At the same time, it also indicates that the resistance mechanism of L. perenne ssp. multiflorum to pyroxsulam is not only TSR but also the NTSR.
In summary, we developed a new rapid detection method that can efficiently and rapidly detect the 197 site mutations (Pro-197-Thr and Pro-197-Gln) in the ALS gene of L. perenne ssp. multiflorum, and acquired the homozygous populations with Pro-197-Thr and Pro-197-Gln mutations from one resistant population. Through the whole-plant bioassays, we found that the Pro-197-Thr population had a higher degree of resistance to ALS-inhibiting herbicides pyroxsulam and mesosulfuron-methyl than the Pro-197-Gln population, indicating that the resistance levels caused by the different mutations in the same target site were quite different. The reason for this difference may result from differences in ALS enzyme activity and/or ALS gene expression. Particularly, when PBO and pyroxsulam were applied, the resistance level of the resistant population to pyroxsulam decreased significantly. This suggests that PBO may reduce weed resistance to herbicides by inhibiting P450 enzyme activity, offering a novel strategy for managing herbicide resistance in weeds.
Funding statement
This research was supported by the National Natural Science Foundation of China (32372567), the National Key R&D Program of China (2023YFD1400501), and the Fundamental Research Funds for the Central Universities (RENCAI2025027).
Competing interests
The authors declare no conflicts of interest.









