Introduction
Vector-borne protist parasites of the order Haemosporida infect vertebrates worldwide and have clinical and ecological importance in birds (Valkiūnas, Reference Valkiūnas2005; Forrester and Greiner, Reference Forrester, Greiner, Atkinson, Thomas and Hunter2008; Pacheco and Escalante, Reference Pacheco and Escalante2023). Infections by Haemoproteus (Parahaemoproteus), family Haemoproteidae, and/or Leucocytozoon parasites (family Leucocytozoidae) can be lethal for captive and free-living birds (Niedringhaus et al., Reference Niedringhaus, Fenton, Cleveland, Anderson, Schwartz, Alex, Rogers, Mete and Yabsley2018; Galosi et al., Reference Galosi, Scaglione, Magi, Cork, Peirce, Ferraro, Cucuzza, Cannizzo and Rossi2019; Groff et al., Reference Groff, Lorenz, Crespo, Iezhova, Valkiūnas and Sehgal2019; Ortiz-Catedral et al., Reference Ortiz-Catedral, Brunton, Stidworthy, Elsheikha, Pennycott, Schulze, Braun, Wink, Gerlach, Pendl, Gruber, Ewen, Pérez-Tris, Valkiūnas and Olias2019; Yoshimoto, Reference Yoshimoto, Ozawa, Kondo, Echigoya, Shibuya, Sato and Sehgal2021). Additionally, simultaneous infections (coinfections) by these parasites may exert greater selective pressure and virulence than single infections, subsequently reducing host survival probability (Halpern and Bennett, Reference Halpern and Bennett1983; Pigeault et al., Reference Pigeault, Cozzarolo, Choquet, Strehler, Jenkins, Delhaye, Bovet, Wassef, Glaizot and Christe2018; Nardoni et al., Reference Nardoni, Parisi, Rocchigiani, Ceccherelli, Mancianti and Poli2020; Nourani et al., Reference Nourani, Aliabadian, Mirshamsi and Djadid2022; Pigeault et al., Reference Pigeault, Chevalier, Cozzarolo, Baur, Arlettaz, Cibois, Keiser, Guisan, Christe and Glaizot2022).
Compared to Haemoproteus and Plasmodium (family Plasmodiidae) haemosporidians, Leucocytozoon parasites are less studied at global and local scales (Fecchio et al., Reference Fecchio, Clark, Bell, Skeen, Lutz, De La Torre, Vaughan, Tkach, Schunck, Ferreira, Braga, Lugarini, Sagario, Cueto, González-Acuña, Inumaru, Sato, Schumm, Quillfeldt, Pellegrino, Dharmarajan, Gupta, Robin, Ciloglu, Yildirim, Huang, Chapa-Vargas, Álvarez-Mendizábal, Santiago-Alarcon, Drovetski, Hellgren, Voelker, Ricklefs, Hackett, Collins, Weckstein and Wells2021; Valkiūnas and Iezhova, Reference Valkiūnas and Iezhova2023). Recent research in the Americas employing molecular techniques shows that Leucocytozoon infection is more frequent in high-altitude Neotropical zones (above 2200 m), such as in the Andes (Galen and Witt, Reference Galen and Witt2014; Lotta et al., Reference Lotta, González, Pacheco, Escalante, Valkiūnas, Moncada and Matta2014, Reference Lotta, Pacheco, Escalante, González, Mantilla, Moncada, Adler and Matta2016, Reference Lotta, Valkiūnas, Pacheco, Escalante, Hernández and Matta2019; Matta et al., Reference Matta, Lotta, Valkiūnas, González, Pacheco, Escalante, Moncada and Rodríguez-Fandiño2014).
Historically, leucocytozoid parasite transmission has been deemed negligible in the Neotropics outside these highland areas, despite the local presence of Simuliidae black flies (Figueiró et al., Reference Figueiró, Gil-Azevedo, Maia-Herzog and Monteiro2012; Docile et al., Reference Docile, Figueiró, Gil-Azevedo and Nessimian2015; Coscarón and Coscarón-Arias, Reference Coscarón, Coscarón-Arias, Adis, Arias, Rueda-Delgado and Wantzen2017; Vieira et al., Reference Vieira, Lima-de-souza, Docile, Nascimento and Figueiró2017; Menzel et al., Reference Menzel, Hentges, Tataje and Strieder2019), the Diptera insects that transmit these parasites (Valkiūnas, Reference Valkiūnas2005). Early reports using microscopy alone showed low rates of Leucocytozoon infection in Neotropical areas (Galindo and Sousa, Reference Galindo and Sousa1966; Forrester et al., Reference Forrester, Greiner and McFarlane1977; White et al., Reference White, Greiner, Bennett and Herman1978; Bennett et al., Reference Bennett, Witt and White1980; Bennett and Lopes, Reference Bennett and Lopes1980; Woodworth-Lynas et al., Reference Woodworth-Lynas, Caines and Bennett1989). However, the recent identification of diverse Leucocytozoon genetic lineages in blood samples from non-migratory birds across most Brazilian biomes (Fecchio et al., Reference Fecchio, Silveira, Weckstein, Dispoto, Anciães, Bosholn and Bell2018, Reference Fecchio, Bell, Bosholn, Vaughan, Tkach, Lutz, Cueto, Gorosito, González-Acuña, Stromlund, Kvasager, Comiche, Kirchgatter, Pinho, Berv, Anciães, Fontana, Zyskowski, Sampaio, Dispoto, Galen, Weckstein and Clark2019; Carvalho et al., Reference Carvalho, Ferreira, Araújo, Hirano, Paludo and Braga2022) provides evidence of broader geographical and environmental scale transmission in the Neotropics. Such findings suggest that microscopy alone may have lower sensitivity to detect infections with low parasitaemia, called submicroscopic infections (Pacheco et al., Reference Pacheco, Ferreira, Logan, McCune, MacPherson, Albino, Miranda, Santiago-Alarcon and Escalante2022). Leucocytozoon sporozoites injected from the vector can remain viable for up to 11 days in the host (Khan et al., Reference Khan, Desser and Fallis1969) and may be amplified by polymerase chain reactions (PCRs) (Valkiūnas et al., Reference Valkiūnas, Iezhova, Loiseau and Sehgal2009). Therefore, molecular-based studies cannot confirm whether the parasites detected can develop into mature gametocytes, precluding the determination of positive bird species as competent hosts (birds that are capable of transmitting the parasite to vectors) for Leucocytozoon in low- and mid-elevation Neotropical areas.
This study provides the first complete morphological characterization of a Leucocytozoon parasite infecting a non-migratory bird, the red-legged seriema (Cariama cristata, henceforth seriemas), in Brazil. Our thorough microscopy screening revealed a new parasite species, Leucocytozoon cariamae n. sp., in coinfection with Haemoproteus pulcher, a parasite recently described by Vanstreels et al. (Reference Vanstreels, Dos Anjos, Leandro, Carvalho, Santos, Egert, Hurtado, Carvalho, Braga and Kirchgatter2022). We recovered the nearly complete mitochondrial genomes (mtDNA) of the 2 parasite genera found in a single seriema using molecular cloning techniques. To improve phylogenetic inferences within Haemoproteus parasites, we sequenced the mtDNA genome of the MalAvi lineage CATAUR01 (Yabsley et al., Reference Yabsley, Vanstreels, Martinsen, Wickson, Holland, Hernandez, Thompson, Perkins, West, Bryan and Cleveland2018; Bensch et al., Reference Bensch, Hellgren and Pérez-Tris2009) of Haemoproteus catharti from a turkey vulture (Cathartes aura) sampled in Pennsylvania, USA. This information was utilized to contextualize the phylogeny of these parasites within the extensive diversity of avian haemosporidians.
Materials and methods
Host description and sampling area
The red-legged seriema (Cariamiformes: Cariamidae) is a non-migratory sedentary species with a mean habitat range of 24 ha, which occupies open-field areas in Brazil, Bolivia, Paraguay, Argentina and Uruguay, where the humid tropical climate predominates (Souza et al., Reference Souza, Vieira and Castro2018; Winkler et al., Reference Winkler, Billerman, Lovette and Keeney2020). The specimen from our study was rescued in the rural area of Mateus Leme (19°59′09″ S, 44°25′40″ W) municipality, Minas Gerais state, Brazil, in December of 2021 and was immediately transferred to the Wildlife Triage Center of Belo Horizonte (Centro de Triagem de Animais Silvestres – CETAS-BH). The location where the bird was rescued is a primarily urbanized mountainous territory with an average altitude of approximately 900 m dominated by sparse trees with tortuous trunks with a continuous grassy stratum, the typical vegetation of the Brazilian Cerrado sensu stricto (Gomes et al., Reference Gomes, Maracahipes, Reis, Marimon, Marimon-Junior and Lenza2016). The climate is classified as humid subtropical with dry winter and temperate summer according to Köppen's classification, with an average annual temperature of 19.3°C and precipitation of approximately 1600 mm (Alvares et al., Reference Alvares, Stape, Sentelhas, de Moraes Gonçalves and Sparovek2013).
Sampling and blood film examination
The seriema was a juvenile individual, unwilling to move, and had evidence of dog bites such as abrasions, bruises and holes in the body. Upon arrival, we physically restrained the specimen and collected 1 mL of blood through the ulnar vein. This material was used to prepare two blood smears on glass slides, which were fixed with 100% methanol for 3 min and stained with 10% Giemsa (pH = 7.2) for 70 min. The remaining blood was stored in 70% ethanol inside a refrigerator for subsequent DNA extraction and molecular analysis.
We analysed the blood smears using an Olympus CX31 microscope. Digital images were captured using an Olympus Qcolor 5 camera and processed with QCapture software. Measurements were made digitally using ImageJ (Schneider et al., Reference Schneider, Rasband and Eliceiri2012). Morphometric parameters were measured following Valkiūnas (Reference Valkiūnas2005), and, for the H. pulcher detected here, they were compared to those found in the original description (Vanstreels et al., Reference Vanstreels, Dos Anjos, Leandro, Carvalho, Santos, Egert, Hurtado, Carvalho, Braga and Kirchgatter2022) using Kruskal–Wallis tests.
Intensity of infection was estimated with an initial analysis of 200 microscopic fields with monolayered blood cells at 1000× magnification. Thus, the intensity of infection was determined by counting the number of parasitized blood cells for a total of 20 000 red blood cells (Godfrey et al., Reference Godfrey, Fedynich and Pence1987). Due to the low Leucocytozoon parasitaemia, we screened almost the entire extension of both blood smears to allow the morphological characterization of this parasite.
DNA extraction, cytb gene amplification and sequencing
For DNA extraction, we followed the protocols described by Scopel et al. (Reference Scopel, Fontes, Nunes, Horta and Braga2004), using a lysis buffer [50 mm NaCl, 50 mm Tris HCl (pH 7.4), 10 mm EDTA; 1% (vol/vol) Triton X-100, 200 μg of proteinase K per mL] for protein lysis in a water bath for at least 18 h at 60°C, followed by the phenol–chloroform extraction method with isopropanol precipitation (Sambrook et al., Reference Sambrook, Fritsch and Maniatis1989). The DNA samples were resuspended in 50 μL of ultrapure water and quantified using NanoDrop 2000 (Thermo Scientific, Waltham, USA®) to certify the presence of DNA in adequate concentrations (40–80 ng/μL) for subsequent assays.
A 4 μL volume of the extraction product was used to amplify a 478 bp region of the Leucocytozoon spp. and Plasmodium spp./Haemoproteus spp. partial mitochondrial cytb gene by a nested PCR according to the protocol described by Hellgren et al. (Reference Hellgren, Waldenström and Bensch2004). PCR products were visualized in a 6% polyacrylamide gel stained in silver nitrate solution.
The amplified product of the nested reaction was purified using identical volumes of polyethylene 20% glycol 6000 (Sambrook and Russell, Reference Sambrook and Russell2001) and bi-directionally sequenced using the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher, Waltham, USA) with a volume of 10 μL, including 2 μL of purified product, 0.5 μL of BigDye, 1.75 μL of Thermo Fisher sequencing buffer, 1 μL of 10 μmol/ L of primer and 4.75 μL of MilliQ water. We used a SimpliAmp Thermal Cycler (Applied Biosystems, Foster City, USA) for 15 s at 96°C, 15 s at 50°C and 4 min at 60°C, repeated for 30 cycles. The products were precipitated, resuspended in formamide and sequenced with dye-terminator fluorescent labelling in an ABI 3730XL sequencer (Applied Biosystems) at Institute René Rachou – Fiocruz/MG. DNA sequences were checked for the presence of mixed infections (presence of double peaks in the electropherogram), edited using ChromasPro 2.0.6 (Technelysium Pty Ltd, Helensvale, Australia) and compared with data available in the public databases GenBank (http://www4.ncbi.nlm.nih.gov) and MalAvi [Bensch et al. (Reference Bensch, Hellgren and Pérez-Tris2009), http://mbio-serv2.mbioekol.lu.se/Malavi/].
In addition to this protocol, the extracted DNA was also screened for the presence of haemosporidians using a nested-PCR protocol that targets the complete parasite cytb gene (1131 bp) with external (AE298 and AE299) and internal primers (AE064 and AE066) described by Pacheco et al. (Reference Pacheco, Cepeda, Bernotienė, Lotta, Matta, Valkiūnas and Escalante2018a, Reference Pacheco, García-Amado, Manzano, Matta and Escalante2019). Using this protocol, sequencing the PCR-amplified products from the primary and the nested PCRs confirmed the presence of H. pulcher (Vanstreels et al., Reference Vanstreels, Dos Anjos, Leandro, Carvalho, Santos, Egert, Hurtado, Carvalho, Braga and Kirchgatter2022) in this sample but not for Leucocytozoon parasites.
DNA extraction and mitochondrial genome (mtDNA) amplification
DNA was also extracted from the whole blood using the QIAamp DNA Micro Kit (Qiagen GmbH, Hilden, Germany). Nearly complete parasite mitochondrial DNA genomes (mtDNA) of H. pulcher and the new Leucocytozoon sp. found in this sample were obtained using a PCR protocol with Takara LA Taq™ polymerase (TaKaRa Takara Mirus Bio, San Jose, USA) following Pacheco et al. (Reference Pacheco, Matta, Valkiūnas, Parker, Mello, Stanley, Lentino, García-Amado, Cranfield, Kosakovsky Pond and Escalante2018b). In addition, to corroborate the phylogenetic relationship between H. pulcher and H. catharti, the mtDNA genome of the MalAvi lineage CATAUR01 of H. catharti from a turkey vulture (C. aura) was also amplified using the same protocol. Haemoproteus pulcher and H. catharti mtDNA genomes were amplified using the oligos forward AE170-5′ GAGGATTCTCTCCACACTTCAATTCGTACTTC 3′ and reverse AE171-5′ CAGGAAAATWATAGACCGAACCTTGGACTC 3′, and in the case of Leucocytozoon sp., mtDNA genome was amplified with specific oligos forward AE1130-5′ ATC AAT TGG GTT TGT GGT GGA TTT ATA ATC 3′ and AE1131-5′ AA AAC TCA TTT GAC CCC ATG GTA GG 3′. PCRs were carried out in 50 μL using 4 μL of the total DNA for each PCR. Negative (distilled water) and positive controls (samples from infected humans) were also included. Amplification conditions for both PCRs were a partial denaturation at 94°C for 1 min and 30 cycles with 30 s at 94°C and 7 min at 67°C, followed by a final extension of 10 min at 72°C. At least 2 independent PCR products (50 μL) were excised from the gel (bands of ~6 kb), purified using the QIAquick Gel extraction kit (Qiagen, GmbH, Hilden, Germany) and cloned into the pGEM-T Easy Vector systems (Promega, Madison, USA) following the manufacturer's instructions. Both strands of 3–5 clones were sequenced at Genewiz from Azenta Life Sciences (New Jersey, USA). Inconsistencies between the clones were not found. The mtDNA genome sequences obtained in this study were identified as Leucocytozoon and Haemoproteus using BLAST (Altschul et al., Reference Altschul, Gish, Miller, Myers and Lipman1990) and submitted to GenBank under accession numbers OQ915109 (H. catharti), OQ915110 (H. pulcher) and OQ915111 (L. cariamae n. sp.).
Phylogenetic analysis
Phylogenetic relationships between the nearly complete mtDNA genomes of the new Leucocytozoon sp., H. pulcher, H. catharti and other haemosporidians were inferred on a mtDNA alignment constructed using ClustalX v2.0.12 and Muscle as implemented in SeaView v4.3.5 (Gouy et al., Reference Gouy, Guindon and Gascuel2010) with manual editing. This alignment (5096 bp excluding gaps) included 74 partial mtDNA genome sequences belonging to 4 genera (Leucocytozoon, Haemoproteus, Haemocystidium and Plasmodium) available from GenBank (Benson et al., Reference Benson, Karsch-Mizrachi, Clark, Lipman, Ostell and Sayers2013) plus the 3 new sequences obtained in this study.
Then, the phylogenetic relationships were inferred on this alignment using 6 partitions (Pacheco et al., Reference Pacheco, Matta, Valkiūnas, Parker, Mello, Stanley, Lentino, García-Amado, Cranfield, Kosakovsky Pond and Escalante2018b). A tree was estimated using a Bayesian method implemented in MrBayes v3.2.7 with the default priors (Ronquist and Huelsenbeck, Reference Ronquist and Huelsenbeck2003). The best model that fitted the data, as estimated by MEGA v7.0.14 (Kumar et al., Reference Kumar, Stecher and Tamura2016), was a general time-reversible model with gamma-distributed substitution rates and a proportion of invariant sites (GTR + Γ + I). Bayesian support was inferred for the nodes in MrBayes by sampling every 1000 generations from 2 independent chains lasting 4 × 106 Markov chain Monte Carlo steps. The chains were assumed to have converged once the value of potential scale reduction factor was between 1.00 and 1.02, and the average standard deviation of the posterior probability was <0.01. Then, 25% of the samples were discarded once convergence was reached as a ‘burn-in’. GenBank accession numbers of all sequences used in this analysis are shown in the phylogenetic tree. In addition, the average evolutionary distance over all sequence pairs of Leucocytozoon spp., and between H. pulcher and H. catharti were estimated using the Tamura–Nei substitution model in MEGA v7.0.14 (Kumar et al., Reference Kumar, Stecher and Tamura2016).
Results
Parasite detection via microscopy and PCR
We found a single Leucocytozoon gametocyte in 20 000 cells analysed initially, revealing a 0.005% parasitaemia. Thus, we screened the almost entire extension of 2 blood smears and found 63 gametocytes (47 macrogametocytes and 16 microgametocytes), 18 of which were not distorted and could be included in the morphological characterization (Fig. 1; Table 1). Results from the nested PCR (Hellgren et al., Reference Hellgren, Waldenström and Bensch2004) revealed the presence of a single Leucocytozoon parasite previously reported in 3 seriemas captured in central Brazil (Carvalho et al., Reference Carvalho, Ferreira, Araújo, Hirano, Paludo and Braga2022).
Macrogametocytes (a–h) and microgametocytes (i–l) of Leucocytozoon cariamae n. sp. from the blood of red-legged seriema (C. cristata) sampled in Brazil. Black arrowheads, parasite nucleus; double white arrowheads, volutin granules; white long arrows, parasite nucleolus; black long arrows, vacuoles; red long arrows, gap between the parasite and the host nucleus; double black arrows, host cell nucleus; asterisk, host cell cytoplasm. Giemsa-stained thin blood films. Scale bar = 10 μm.

Morphometric parameters of mature gametocytes of Leucocytozoon cariamae n. sp. and its host cells from the peripheral blood of the red-legged seriema (Cariama cristata).

Minimum and maximum values are provided, followed in parentheses by the arithmetic mean and standard deviation.
Additionally, 1.3% of the analysed erythrocytes were infected by Haemoproteus parasite gametocytes. This parasite displayed general characteristics similar to H. pulcher (Vanstreels et al., Reference Vanstreels, Dos Anjos, Leandro, Carvalho, Santos, Egert, Hurtado, Carvalho, Braga and Kirchgatter2022), except for the greater number of pigment granules in microgametocytes (P < 0.05), the presence of volutin granules concentrated in the periphery of the parasite (Fig. 2c and e), the common presence of 1 or 2 large cytoplasmic vacuoles in macrogametocytes (Fig. 2a–d and g), the absence of gametocytes that almost encircle the erythrocyte nucleus and the absence of rounded erythrocyte nucleus in infected cells (Fig. 2; Supplementary Table S1). Additional 12 measurements showed statistically significant differences between the H. pulcher reported here and the original description (Supplementary Table S1), with all but 2 measurements (macrogametocyte and microgametocyte nuclei) showing greater values in our description. Sequencing the positive band obtained from the second nested-PCR protocol used in this study (Pacheco et al., Reference Pacheco, Cepeda, Bernotienė, Lotta, Matta, Valkiūnas and Escalante2018a) confirmed the presence of H. pulcher, with 100% identity in relation to the original parasite description (Vanstreels et al., Reference Vanstreels, Dos Anjos, Leandro, Carvalho, Santos, Egert, Hurtado, Carvalho, Braga and Kirchgatter2022) at the cytb level after trimming the primer regions.
Macrogametocytes (a–h) and microgametocytes (i–l) of Haemoproteus pulcher from the blood of red-legged seriema (Cariama cristata) sampled in Brazil. Black arrowheads, parasite nucleus; white arrowheads, pigment granules; double white arrowheads, volutin granules; black long arrows, vacuoles; double black arrowheads, host cell nucleus. Giemsa-stained thin blood films. Scale bar = 10 μm.

Description of Leucocytozoon (Leucocytozoon) cariamae n. sp.
Macrogametocytes (Fig. 1a–h)
Develop in roundish host cells. Gametocytes are roundish; host cells do not produce fusiform processes. Parasite nucleus varies from rounded (Fig. 1a, b and f) to oval (Fig. 1c, e, g and h), occupying median (Fig. 1a–d) or peripheral (Fig. 1e, g and h) region. Nucleolus is visible in only 28% of the gametocytes (Fig. 1a, e, f and h). Volutin granules are abundant throughout the cytoplasm (Fig. 1c, e and f). Cytoplasmic vacuoles, when present, are small and can be mistaken for zones lacking volutin (Fig. 1e and g). The host cell nucleus is markedly displaced to the periphery and deformed into a band-like shape (Fig. 1c–h) that always extends less than half of the gametocyte's circumference (Table 1). Host cell nucleus can also be roundish (Fig. 1a and b). Variable-shaped host cell cytoplasm remnants commonly surround the gametocytes (Fig. 1b and d–g).
Microgametocytes (Fig. 1i–l)
Microgametocytes display a unique character of the species: the parasite does not touch or is not strongly appressed to the host cell's nucleus, always leaving a slight gap between them (Fig. 1i–l). Other than that, microgametocytes have the same general characteristics as macrogametocytes, except for common dimorphic ones, such as paler staining of the cytoplasm, a more dispersed nucleus (Fig. 1k) and smaller general size parameters (Table 1). Microgametocytes seem to have fewer vacuoles and volutin granules than macrogametocytes, although these parameters were not quantified.
Remarks
Leucocytozoon cariamae n. sp. exclusively develops in round host cells and can be easily distinguished from other leucocytozoids due to a feature present in microgametocytes, which do not or only slightly touch the host cell's nucleus. The absence of numerous vacuoles and of a prominent nucleolus in L. cariamae n. sp. helps to distinguish it from Leucocytozoon dubreuili, from the fringillinarum group, which typically display rounded gametocytes (Valkiūnas, Reference Valkiūnas2005). As there is no convincing experimental evidence that the same Leucocytozoon species infects and fully develop to produce gametocytes in birds belonging to different orders (Valkiūnas and Iezhova, Reference Valkiūnas and Iezhova2023), this first description in the order Cariamiformes establishes L. cariamae n. sp. as a new parasite species.
Taxonomic summary
Type host: The red-legged seriema, Cariama cristata (Cariamiformes, Cariamidae).
Additional hosts: Unknown.
Type locality: Rural area of Mateus Leme (19°59′09″ S, 44°25′40″ W), Minas Gerais, Brazil.
Type specimen: Hapantotype was deposited in the biological collection of the Muséum Nation d'Histoire Naturelle, Paris, France; the intensity of parasitaemia is 0.005%, collected by Lis Marques in the CETAS-BH, Minas Gerais, 13 December 2021.
DNA sequences: The partial mitochondrial cytochrome b fragment (478 bp) obtained corresponded in 100% identity to the lineage CARCRI01 (GenBank acc. no. OK086053 from 3 specimens of red-legged seriemas, C. cristata). The nearly complete mtDNA genome (acc. no. OQ915111) corresponded to the same genetic lineage that is already deposited in GenBank (acc. no. KX832566).
Site of infection: Blood cells, for which origin could not be identified due to the marked deformation caused by L. cariamae n. sp. gametocytes.
Additional hosts and localities: Only 1 bird was evaluated in this study. However, Carvalho et al. (Reference Carvalho, Ferreira, Araújo, Hirano, Paludo and Braga2022) found that 3 out of 3 red-legged seriemas captured in central Brazil were positive by PCR for this parasite.
Etymology: The species name refers to the genus ‘Cariama’, the single genus of the order Cariamiformes.
Molecular and phylogenetic analyses
Cytb gene BLAST analysis
The result of BLASTn using the partial cytb sequence of L. cariamae n. sp. as query returned 100% identity and 100% coverage in relation to the CARCRI01 lineage (OK086053) also found in seriemas sampled in the Brazilian Cerrado (Carvalho et al., Reference Carvalho, Ferreira, Araújo, Hirano, Paludo and Braga2022). The most closely related Leucocytozoon lineage reported (GenBank acc. no. KX832566) has 0.035 genetic distance in relation to L. cariamae n. sp. and was found in common wood pigeons (Columba palumbus) from the UK (see Fig. 1 in Carvalho et al., Reference Carvalho, Ferreira, Araújo, Hirano, Paludo and Braga2022). Leucocytozoon cariamae n. sp. has 0.042 genetic distance in relation to Leucocytozoon podargii described infecting tawny frogmouths (Podargus strigoides) in Australia (Jiang et al., Reference Jiang, Brice, Nguyen, Loh, Greay, Adlard, Ryan and Yang2019), and to Leucocytozoon californicus infecting American kestrel (Falco sparverius) in California, USA (Walther et al., Reference Walther, Valkiūnas, Wommack, Bowie, Iezhova and Sehgal2016).
mtDNA phylogenetic analysis
Given that a comprehensive phylogenetic analysis using partial cytb gene sequences was already published in 2022 (see Fig. 1 in Carvalho et al., Reference Carvalho, Ferreira, Araújo, Hirano, Paludo and Braga2022), here we focus on the Bayesian phylogenetic hypothesis using the nearly complete mtDNA genomes (Fig. 3; Supplementary Fig. S1). The parasite with the closest relationship to L. cariamae n. sp. that has been sequenced at the mtDNA genome level is Leucocytozoon sp. TFUS14 (genetic distance = 0.101 ± 0.005), which was detected in a great thrush (Turdus fuscater, GenBank acc. no. KT162002) from Colombia. These 2 Leucocytozoon parasites, together with Leucocytozoon quynzae (from Heliangelus amethysticollis sampled in Colombia, KF479480) and Leucocytozoon majoris (from Zonotrichia leucophrys oriantha sampled in North America, FJ168563) are part of a monophyletic group that share a common ancestor with a clade of diverse Leucocytozoon fringillinarum lineages (from several hosts; Fig. 3) and with L. dubreuili (Turdus merula, KY653795). The mtDNA genome average genetic distances for these 2 clades are shown in Table 2.
Bayesian phylogenetic hypothesis of haemosporidian parasites infecting red-legged seriema (C. cristata) sampled in Brazil. The phylogenetic tree was computed based on 74 partial parasites mtDNA genomes (5096 bp excluding gaps) belonging to 4 genera. The values above branches are posterior probabilities. Species found in this study are shown in orange, and the light-yellow boxes indicate their respective clade. GenBank accession numbers (as deposited in the MalAvi database) and their hosts are provided in parentheses for the sequences used in the analysis. More details about the species included in this analysis can be found in Supplementary Fig. S1.

Estimates of pairwise genetic distance using nearly complete mtDNA genomes among haemosporidian parasites

The percentage of base substitutions per site between sequences and their standard error estimate(s) are shown below and above the diagonal, respectively. Analyses were conducted using the Tamura–Nei model. Estimates for those parasites found in C. cristata and its closely related parasite are shown in bold.
Haemoproteus pulcher from the seriema and the H. catharti from the turkey vulture, for which mtDNA sequence we provided here, are sister taxa (genetic distance = 0.068 ± 0.004) and shared a common ancestor with Haemocystidium parasites infecting Reptilia in South America, Africa and Australasia (Pacheco et al., Reference Pacheco, Ceríaco, Matta, Vargas-Ramírez, Bauer and Escalante2020; Fig. 3, Supplementary Fig. S1). These 2 clades shared a common ancestor with parasites belonging to the genus Plasmodium. The mtDNA genome average genetic distances among H. pulcher, H. catharti and Haemocystidium spp. are shown in Table 2.
Discussion
Our study is the first to provide morphological evidence of Leucocytozoon parasites infecting birds outside highland areas in the Neotropics. Because the host is a non-migratory species, it strongly supported that leucocytozoids are transmitted in the region. The first detection of a leucocytozoid infecting Cariamiformes birds enabled us to propose this newly discovered parasite as L. cariamae n. sp.
The presence of few forms of L. cariamae n. sp. on the slides we analysed (1 parasite detected during the examination of 200 microscopic fields at 1000× magnification) agrees with the general low parasitaemia observed in natural Leucocytozoon infections (Chagas et al., Reference Chagas, Duc, Gutiérrez-Liberato and Valkiūnas2023; Valkiūnas and Iezhova, Reference Valkiūnas and Iezhova2023). Indeed, microscopy alone underestimates the prevalence of haemosporidian parasites (Pacheco et al., Reference Pacheco, Ferreira, Logan, McCune, MacPherson, Albino, Miranda, Santiago-Alarcon and Escalante2022). However, this technique informs about host competence via visualization of gametocytes in blood smears (Valkiūnas and Iezhova, Reference Valkiūnas and Iezhova2023), making it an important tool in avian Haemosporida research. Future studies evaluating seriemas with higher parasitaemia and displaying early stages of L. cariamae n. sp. are desirable to determine the type of blood cell utilized by the parasite described here. This parasitological trait may have phylogenetic value (Chagas et al., Reference Chagas, Duc, Gutiérrez-Liberato and Valkiūnas2023) and should be further investigated.
We observed a coinfection between Leucocytozoon and Haemoproteus by using different diagnostic methods. Haemoproteus pulcher was not detected by the commonly used PCR protocol targeting the mtDNA cytb developed by Hellgren et al. (Reference Hellgren, Waldenström and Bensch2004), as reported by Vanstreels et al. (Reference Vanstreels, Dos Anjos, Leandro, Carvalho, Santos, Egert, Hurtado, Carvalho, Braga and Kirchgatter2022), while L. cariamae n. sp. was not detected using the protocol described by Pacheco et al. (Reference Pacheco, Cepeda, Bernotienė, Lotta, Matta, Valkiūnas and Escalante2018a, Reference Pacheco, Matta, Valkiūnas, Parker, Mello, Stanley, Lentino, García-Amado, Cranfield, Kosakovsky Pond and Escalante2018b) to target the same gene. Although costly, the use of several PCR protocols combined with microscopy should be favoured in avian haemosporidian studies (Feldman et al., Reference Feldman, Freed and Cann1995; Jarvi et al., Reference Jarvi, Schultz and Atkinson2002; Richard et al., Reference Richard, Sehgal, Jones and Smith2002; Valkiūnas et al., Reference Valkiūnas, Iezhova, Križanauskiené, Palinauskas, Sehgal and Bensch2008; Braga et al., Reference Braga, Silveira, Belo and Valkiūnas2011; Clark et al., Reference Clark, Clegg and Lima2014).
The Bayesian phylogenetic analysis performed with nearly complete mitochondrial genomes (Fig. 3; Supplementary Fig. S1; Table 2) showed that L. cariamae does not share a recent common ancestor with the fringillinarum group. This supports our morphological findings and previous phylogenetic results obtained using the cytb gene fragment (Carvalho et al., Reference Carvalho, Ferreira, Araújo, Hirano, Paludo and Braga2022). The closest Leucocytozoon cytb lineage (GenBank acc. no. KX832566) has 96.45% similarity to L. cariamae n. sp. and was found in a host native to the western Palaearctic, from an avian order (Columbiformes) phylogenetically distant from the Cariamiformes (Jarvis et al., Reference Jarvis, Mirarab, Aberer, Li, Houde, Li, Ho, Faircloth, Nabholz, Howard, Suh, Weber, da Fonseca, Li, Zhang, Li, Zhou, Narula, Liu, Ganapathy, Boussau, Bayzid, Zavidovych, Subramanian, Gabaldón, Capella-Gutiérrez, Huerta-Cepas, Rekepalli, Munch, Schierup, Lindow, Warren, Ray, Green, Bruford, Zhan, Dixon, Li, Li, Huang, Derryberry, Bertelsen, Sheldon, Brumfield, Mello, Lovell, Wirthlin and Zhang2014; Prum et al., Reference Prum, Berv, Dornburg, Field, Townsend, Lemmon and Lemmon2015; see Fig. 1 in Carvalho et al., Reference Carvalho, Ferreira, Araújo, Hirano, Paludo and Braga2022). Because Leucocytozoon diversity is relatively underreported compared to parasites belonging to the genera Plasmodium and Haemoproteus (Fecchio et al., Reference Fecchio, Clark, Bell, Skeen, Lutz, De La Torre, Vaughan, Tkach, Schunck, Ferreira, Braga, Lugarini, Sagario, Cueto, González-Acuña, Inumaru, Sato, Schumm, Quillfeldt, Pellegrino, Dharmarajan, Gupta, Robin, Ciloglu, Yildirim, Huang, Chapa-Vargas, Álvarez-Mendizábal, Santiago-Alarcon, Drovetski, Hellgren, Voelker, Ricklefs, Hackett, Collins, Weckstein and Wells2021; Valkiūnas and Iezhova, Reference Valkiūnas and Iezhova2023), further Haemosporida biodiversity research is needed to uncover species and/or genetic lineages closely related to L. cariamae n. sp. Specifically, it would be of notable interest to analyse the other member of the Cariamiformes, the black-legged seriema (Chunga burmeisteri), for the presence of haemosporidians.
Two Leucocytozoon morphospecies with the highest similarity to L. cariamae n. sp. parasitize birds from different orders and display morphological differences in relation to the new species described here. Leucocytozoon podargii infects Caprimulgiformes birds (tawny frogmouths) in the Australasian region (Adlard et al., Reference Adlard, Peirce and Lederer2002; Jiang et al., Reference Jiang, Brice, Nguyen, Loh, Greay, Adlard, Ryan and Yang2019). This parasite displays a granular cytoplasm, about half of the gametocytes were found in host cells without a remaining nucleus and microgametocytes are present in a very low proportion (Adlard et al., Reference Adlard, Peirce and Lederer2002). These characters are not observed in L. cariamae n. sp. Another closely related morphospecies, L. californicus, has been found in F. sparverius in California, USA (Walther et al., Reference Walther, Valkiūnas, Wommack, Bowie, Iezhova and Sehgal2016). This bird species shares its habitat with seriemas in the Brazilian territory, and belongs to the Falconiformes order, a sister group of Cariamiformes (Jarvis et al., Reference Jarvis, Mirarab, Aberer, Li, Houde, Li, Ho, Faircloth, Nabholz, Howard, Suh, Weber, da Fonseca, Li, Zhang, Li, Zhou, Narula, Liu, Ganapathy, Boussau, Bayzid, Zavidovych, Subramanian, Gabaldón, Capella-Gutiérrez, Huerta-Cepas, Rekepalli, Munch, Schierup, Lindow, Warren, Ray, Green, Bruford, Zhan, Dixon, Li, Li, Huang, Derryberry, Bertelsen, Sheldon, Brumfield, Mello, Lovell, Wirthlin and Zhang2014; Prum et al., Reference Prum, Berv, Dornburg, Field, Townsend, Lemmon and Lemmon2015). However, L. californicus exhibits characteristics not observed in L. cariamae n. sp.: the host cell nucleus is often positioned above the gametocyte and microgametocytes are strongly appressed to the host cell nuclei (Walther et al., Reference Walther, Valkiūnas, Wommack, Bowie, Iezhova and Sehgal2016). None of these morphospecies have infected cells showing a small gap between the microgametocyte and the host nucleus (Fig. 1i–l), which seems to be a distinguishing feature of L. cariamae n. sp.
Our morphological evidence that Leucocytozoon parasites are transmitted in Brazil emphasizes that future studies should elucidate the diversity of competent vertebrate hosts in the Neotropics at low- and mid-elevation areas. Furthermore, evaluating Neotropical species of black flies for the presence of Leucocytozoon is another urgent task as this was explored only once (Lotta et al., Reference Lotta, Pacheco, Escalante, González, Mantilla, Moncada, Adler and Matta2016). According to Merino et al. (Reference Merino, Moreno, Vásquez, Martínez, Sánchez-Monzálvez, Estades, Ippi, Sabat, Rozzi and Mcgehee2008), Cuevas et al. (Reference Cuevas, Vianna, Botero-Delgadillo, Doussang, González-Acuña, Barroso, Rozzi, Vásquez and Quirici2019) and Fecchio et al. (Reference Fecchio, Bell, Bosholn, Vaughan, Tkach, Lutz, Cueto, Gorosito, González-Acuña, Stromlund, Kvasager, Comiche, Kirchgatter, Pinho, Berv, Anciães, Fontana, Zyskowski, Sampaio, Dispoto, Galen, Weckstein and Clark2019), latitude was the most influential factor for the distribution of parasites of the genus Leucocytozoon, but altitude and local climate are also important variables to be considered (Greiner et al., Reference Greiner, Bennett, White and Coombs1975; Lotta et al., Reference Lotta, Pacheco, Escalante, González, Mantilla, Moncada, Adler and Matta2016; Cuevas et al., Reference Cuevas, Vianna, Botero-Delgadillo, Doussang, González-Acuña, Barroso, Rozzi, Vásquez and Quirici2019). This would explain why the higher prevalence of leucocytozoids in the Neotropics would be more restricted to mountainous areas. Although Leucocytozoon development within black flies may be constrained by the year-round high temperature in some areas of the Neotropics (Fecchio et al., Reference Fecchio, Bell, Bosholn, Vaughan, Tkach, Lutz, Cueto, Gorosito, González-Acuña, Stromlund, Kvasager, Comiche, Kirchgatter, Pinho, Berv, Anciães, Fontana, Zyskowski, Sampaio, Dispoto, Galen, Weckstein and Clark2019), our results confirm a competent host in the Brazilian Cerrado, a requirement to sustain local transmission.
Considering that we initially screened 20 000 blood cells and found a single L. cariamae n. sp. gametocyte among high numbers of H. pulcher gametocytes, we recommend that future studies targeting Leucocytozoon in Neotropical areas conduct thorough blood smear analyses to avoid missing infections with such low parasitaemia. This has been reported in other haemosporidian parasites (Pacheco et al., Reference Pacheco, Ferreira, Logan, McCune, MacPherson, Albino, Miranda, Santiago-Alarcon and Escalante2022). This will also avoid underestimating possible coinfections, a common feature in Leucocytozoon infections (Chagas et al., Reference Chagas, Duc, Gutiérrez-Liberato and Valkiūnas2023). Molecular approaches targeting Leucocytozoon parasites have been applied only recently in population- and community-wide studies in Brazil (Fecchio et al., Reference Fecchio, Silveira, Weckstein, Dispoto, Anciães, Bosholn and Bell2018, Reference Fecchio, Bell, Bosholn, Vaughan, Tkach, Lutz, Cueto, Gorosito, González-Acuña, Stromlund, Kvasager, Comiche, Kirchgatter, Pinho, Berv, Anciães, Fontana, Zyskowski, Sampaio, Dispoto, Galen, Weckstein and Clark2019; Anjos et al., Reference Anjos, Chagas, Fecchio, Schunk, Costa-Nascimento, Monteiro, Mathias, Bell, Guimaraes, Comiche, Valkiūnas and Kirchgatter2021; Carvalho et al., Reference Carvalho, Ferreira, Araújo, Hirano, Paludo and Braga2022); making evident the historical under-sampling of parasites of the genus in the Neotropics. Therefore, future haemosporidian studies in Neotropical areas should include parasites of the genus Leucocytozoon in their molecular (preferably using several primer sets that amplify not only the partial cytb gene but also the mtDNA genome) and microscopy analyses.
The H. pulcher detected here displays some morphological differences in relation to the original description, likely representing inter-population morphological variation within this parasite species. Additionally, differences such as the presence or absence of volutin granules, which can vary among samples collected from the same host species at the same location (Valkiūnas, Reference Valkiūnas2005; Ferreira-Junior et al., Reference Ferreira-Junior, Dutra, Martins, Valkiūnas and Braga2018), may be due to variations in blood smear preparation (Valkiūnas, Reference Valkiūnas2005). Differences in the mensuration of the morphological characters and/or microscope calibration should also be taken into account since most measurements (10 out of 12) were greater in the parasite described here, and because the length and width of uninfected erythrocyte nuclei also varied between our study and the original description (Vanstreels et al., Reference Vanstreels, Dos Anjos, Leandro, Carvalho, Santos, Egert, Hurtado, Carvalho, Braga and Kirchgatter2022). However, this can also be explained by variations in erythrocyte morphology between birds from different populations (Haas and Janiga, Reference Haas and Janiga2020). Therefore, the morphological characters described here should be considered in the taxonomy of H. pulcher.
Haemoproteus pulcher was the first haemosporidian to be fully described in C. cristata (Vanstreels et al., Reference Vanstreels, Dos Anjos, Leandro, Carvalho, Santos, Egert, Hurtado, Carvalho, Braga and Kirchgatter2022) and was detected in our study using the nested-PCR protocol by Pacheco et al. (Reference Pacheco, Cepeda, Bernotienė, Lotta, Matta, Valkiūnas and Escalante2018a). Previous phylogenetic analysis using the cytb fragment placed this parasite and H. catharti in an unresolved position in a clade with a low posterior probability (pp = 0.52) between Haemocystidium spp. and Plasmodium spp. (see Fig. 2 in Vanstreels et al., Reference Vanstreels, Dos Anjos, Leandro, Carvalho, Santos, Egert, Hurtado, Carvalho, Braga and Kirchgatter2022). However, the phylogenetic tree obtained with nearly complete mitochondrial genomes indicated, with high node supports (pp = 1.0), that H. pulcher and H. catharti form a monophyletic group that shares a common ancestor with the Haemocystidium clade found in reptiles globally (Pacheco et al., Reference Pacheco, Ceríaco, Matta, Vargas-Ramírez, Bauer and Escalante2020).
Haemocystidium parasites produce microscopically visible haemozoin pigment and do not produce erythrocytic meronts in peripheral blood, traits that are shared with Haemoproteus parasites (González et al., Reference González, Pacheco, Escalante, Jiménez Maldonado, Cepeda, Rodríguez-Fandiño, Vargas-Ramírez and Matta2019). This underscores molecular and morphological convergence among the Haemocystidium and Haemoproteus parasites. However, based on similar morphological aspects of tissue meronts between Plasmodium and Haemocystidium, this genus has been considered part of the family Plasmodiidae instead of Haemoproteidae (Telford, Reference Telford1996). The fact that the clade containing H. pulcher, H. catharti and lizard Haemocystidium shares a common ancestor with the species belonging to the genus Plasmodium (Fig. 3; Supplementary Fig. S1) indicates this as a viable hypothesis. Our study shows that H. pulcher and H. catharti are not closely related to H. (Parahaemoproteus) spp. and H. (Haemoproteus) spp., corroborating findings by Galen et al. (Reference Galen, Borner, Martinsen, Schaer, Austin, West and Perkins2018) based on sequencing data from multiple nuclear loci showing that H. catharti is not closely related to Haemoproteidae parasites. Haemoproteus is a polyphyletic group (Pacheco and Escalante, Reference Pacheco and Escalante2023), and whereas solving this taxonomic issue will require additional work, Vanstreels et al. (Reference Vanstreels, Dos Anjos, Leandro, Carvalho, Santos, Egert, Hurtado, Carvalho, Braga and Kirchgatter2022) proposed that H. pulcher and H. catharti may constitute a new genus to be described. Based on our phylogenetic data at the mitochondrial genome level, placing these parasites in the genus Haemocystidium should be explored in future taxonomic revisions of Haemosporida when more mtDNA genomes become available for these groups of parasites.
Conclusions
Despite the challenge of detecting the parasite due to the typically low intensity of parasitaemia in natural infections, we successfully identified and described a new species of Leucocytozoon. The description of L. cariamae n. sp. adds morphological evidence that leucocytozoids are transmitted outside highland areas in the Neotropics and characterizes red-legged seriemas as a competent host for this parasite group. The robust phylogenetic analysis presented here provides evidence at the mitochondrial genome level that H. pulcher and H. catharti are more closely associated with the reptile parasites Haemocystidium and with bird Plasmodium than with other bird-infecting Haemoproteus. This finding supports the polyphyly of the genus Haemoproteus or may indicate that H. pulcher and H. catharti might in fact compose the genus Haemocystidium. These hypotheses have broad implications for our understanding of the evolutionary relationships within Haemosporida.
Supplementary material
The supplementary material for this article can be found at https://doi.org/10.1017/S0031182023000811
Data availability statement
The mtDNA genome sequences obtained in this study are deposited on GenBank under accession numbers OQ915109 (Haemoproteus catharti), OQ915110 (Haemoproteus pulcher) and OQ915111 (Leucocytozoon cariamae n. sp.).
Acknowledgements
We thank the entire CETAS-BH team of professionals and volunteers for supporting the research and helping with the collection phase.
Author's contribution
Conceived and designed the experiments: L. M. C. V., F. C. F. and E. M. B. Performed the experiments: L. M. C. V., P. H. O. P. and M. A. P. Analysed the data: L. M. C. V., I. L., M. A. P., A. A. E., F. C. F. and E. M. B. Contributed reagents/materials/analysis tools: D. A. R. V., E. M. B., M. A. P. and A. A. E.. Wrote the paper: L. M. C. V., M. A. P., A. A. E., F. C. F. and E. M. B.
Financial support
This work was supported by Fundação de Amparo à Pesquisa do Estado de Minas Gerais – FAPEMIG (grant number APQ-00645-18); Conselho Nacional de Desenvolvimento Científico e Tecnológico – CNPq (grant number 304334/2019-7) and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES). Ananias A. Escalante and M. Andreína Pacheco are funded by the US National Science Foundation (grant number NSF-DEB 2146653). The funders had no role in study design, data collection and analysis, the decision to publish or the preparation of the manuscript.
Competing interests
None.
Ethical standards
This study was approved by the Ethics Committee in Animal Experimentation (CETEA), Universidade Federal de Minas Gerais, Brazil (Protocol 46/2018), by the Sistema de Autorização e Informação em Biodiversidade – SISBIO (Protocol 80285-1) and by the Instituto Estadual de Florestas – IEF (Protocol 38385587).


