Introduction
Nematodes of the family Capillariidae Railliet, 1915 are thin, threadlike roundworms characterized by stichosome-type oesophagi and barrel-shaped eggs. Approximately, 390 nominal species have been reported from a wide range of vertebrate hosts, including fishes, reptiles, amphibians, birds, mammals and humans (Moravec, Reference Moravec2001a; Hodda, Reference Hodda and Zhang2011; Carvalho et al., Reference Carvalho, Santana, Sindeaux Neto, Silva and Giese2023). Among these, 33 valid species of capillariids were described in fishes across various water bodies. These include species in the genus Capillaria Moravec, 1987, where 15 species are known from freshwater, brackish-water and marine fishes (Moravec et al., Reference Moravec, Nagasawa and Madinabeitia2010; Moravec and Justine, Reference Moravec and Justine2014; Moravec and Barton, Reference Moravec and Barton2018). The 15 species are: Capillaria acanthopagri Moravec, Nagasawa & Madinabeitia, 2010 (Moravec et al., Reference Moravec, Nagasawa and Madinabeitia2010); Capillaria appendigera Moravec & Barton, 2017 (Moravec and Barton, Reference Moravec and Barton2018); Capillaria carioca Freitas & Lent, 1935 (Moravec et al., Reference Moravec, Vargas Vázquez, Mendoza Franco and Vivas Rodríguez1995a); Capillaria catenata Van Cleave & Mueller, 1932 (Moravec, Reference Moravec2001b); Capillaria cichlasomae Moravec, Scholz & Mendoza-Franco, 1995 (Moravec et al., Reference Moravec, Scholz and Mendoza Franco1995b); Capillaria cooperi Johnston & Mawson, 1945 (Moravec, Reference Moravec2001b); Capillaria cyprinodonticola Huffman & Bullock, 1973 (Huffman and Bullock, Reference Huffman and Bullock1973); Capillaria gracilis (Bellingham, 1840) (Arai and Smith, Reference Arai and Smith2016); Capillaria hakofugu Araki & Machida, 1991 (Araki and Machida, Reference Araki and Machida1991); Capillaria margolisi Moravec & McDonald, 1981 (Moravec and McDonald, Reference Moravec and McDonald2011); Capillaria novonae Timi, Rossin & Lanfranchi, 2006 (Timi et al., Reference Timi, Rossin and Lanfranchi2006); Capillaria plectropomi Moravec & Justine, 2014 (Moravec and Justine, Reference Moravec and Justine2014); Capillaria pterophylli Heinze, 1933 (Moravec and Gut, Reference Moravec and Gut1982); Capillaria schmidti Arya, 1985 (Arya, Reference Arya1985) and Capillaria wickinsi Ogden, 1965 (Ogden, Reference Ogden1965). Based on morphological differences in the male caudal end, female vulva and egg structure, Moravec (Reference Moravec1987) proposed dividing Capillaria species from fishes into four subgenera: Capillaroides Moravec, 1987; Hepatocapillaria Moravec, 1987; Neocapillaria Moravec 1987; and Procapillaria Moravec, 1987 (Moravec, Reference Moravec1987).
Although numerous Capillaria species have been documented across a variety of hosts, taxonomic resolution remains challenging due to their minute size and fragile morphological structures (Borba et al., Reference Borba, Machado-Silva, Le Bailly and Iñiguez2019). Additionally, molecular data of capillariids remains limited, with most species described solely based on morphological characters (Moravec and Justine, Reference Moravec and Justine2014; Moravec and Barton, Reference Moravec and Barton2018). In particular, no molecular data is currently available for any capillariid species infecting fishes, and species identification or description in this group continues to rely exclusively on morphological traits and presumed host specificity. However, the widespread occurrence of cryptic species and morphological plasticity among nematodes complicates taxonomy based solely on morphology (Daly et al., Reference Daly, Meester, Baetens, Moens and Baets2021; Mondal et al., Reference Mondal, Purohit, Hazra, Das, Chakrabarti, Khan, Lopez-Nicora, Chakraborti and Mukherjee2024). Given these limitations, the integration of molecular data is increasingly recognized as essential for reliable species identification.
Scomberomorus commerson (Lacèpéde, 1800), commonly known as the narrow-barred Spanish mackerel, is a large predatory epipelagic marine fish distributed throughout the tropical Indian and Pacific Oceans, including the Gulf of Thailand (Sulaiman and Ovenden, Reference Sulaiman and Ovenden2009; Chen et al., Reference Chen, Weng, Naimullah, Hsiao, Tseng, Lan and Chuang2021). It is a commercially important fish species in Thailand, where it is widely targeted, traded, and sold in regional markets. Despite the rich marine biodiversity in the Gulf of Thailand, information on the helminth fauna of marine fishes in the region remains limited. To date, no report is available on helminths infecting S. commerson. During a survey on helminths infecting mackerels caught off the coast of Ang Sila in Chon Buri Province, capillariids were recovered from the intestine of S. commerson. Morphological examination revealed distinct characters that did not match with other capillariids described in marine fishes. Morphological differences, coupled with genetic information from nuclear and mitochondrial genetic markers, supplement the proposition that the capillariids represent a new species.
Here, we describe Capillaria nubthaiensis sp. nov. as a new species infecting S. commerson from the Gulf of Thailand. The results obtained mark the first integration of morphological and molecular evidence for a capillariid in marine fish, providing crucial information to enhance existing knowledge on the taxonomy of Capillariidae. Additionally, C. nubthaiensis sp. nov. is the first Capillaria species to be described from a marine fish in Thailand, contributing to Thailand’s nematode fauna.
Materials and methods
Specimen preparation
Twenty S. commerson were obtained from Ang Sila market in Chon Buri Province, Thailand, from July 2024 to April 2025. The fish sold at the market were caught off the coast of Ko Si Chang, from the Gulf of Thailand. The fish were kept on ice and transported back to the Department of Helminthology, Faculty of Tropical Medicine. The narrow-barred Spanish mackerels were weighed, measured, and dissected within the day of collection. The internal organs of the gastrointestinal tract (stomach, intestine, and pyloric caeca) were examined under a stereomicroscope for the presence of parasites. The capillariids were isolated, washed in normal saline, and preserved in 70% ethanol at – 20°C for morphological and molecular identification. Additionally, 5 male and 5 female specimens were selected and preserved in 2.5% glutaraldehyde for scanning electron microscopy (SEM).
Morphological study
Morphological identification and morphometric measurements were conducted on 60 complete Capillaria specimens (30 males and 30 females). Morphological identification followed the Key to Nematoda to the family level (Gibbons, Reference Gibbons2010), followed by the Key to genera by Moravec and Spratt (Reference Moravec and Spratt1998) (Moravec and Spratt, Reference Moravec and Spratt1998), and subsequent comparisons with other Capillaria species in marine fishes. The identification and measurements were conducted using an inverted microscope (Zeiss, Primovert, Germany) equipped with a Zeiss Axiocam and ZEN2 blue edition software. The morphometric measurements are presented in Supplementary File 1. Selected specimens were mounted in glycerine jelly and double-mounted with permount to obtain permanent slides. Illustrations were drawn under a light microscope with a camera lucida (Leitz, Wetzlar, Germany).
Scanning electron microscope study
The 5 male and 5 female specimens for SEM analysis were fixed in 2.5% glutaraldehyde in a 0.1 M sucrose phosphate buffer (SPB) and subsequently fixed in 1% osmium tetroxide solution in 0.1 M SPB. They were then dehydrated with ethanol and dried using a critical point drying device (CPD300 auto, Leica, Wetzlar, Germany). Gold material coating was applied using a coat-sputter (Q150R PLUS, Quorum, East Sussex, England), and the specimens were examined under the SEM (JSM-6610LV, JEOL, Tokyo, Japan).
Molecular study
Representative specimens were individually placed in 1.5 ml microcentrifuge tubes and washed thoroughly with sterile distilled water. Total genomic DNA was isolated using the Geneaid genomic DNA mini kit (Geneaid Biotech Ltd., Taipei, Taiwan) following the manufacturer’s recommendations.
The partial nuclear 18S rRNA and mitochondrial COI gene were amplified using the following primers: 18SF 5’ – ATGGCTCATTAAATCAGCTAT – 3’ and 18SR 5’ – TGCTTTGAGCACTCAAATTTG – 3’ for the 18S rRNA gene (Routtu et al., Reference Routtu, Grunberg, Izhar, Dagan, Guttel, Ucko and Ben-Ami2014) and JB3 5’ – TTTTTTGGGCATCCTGAGGTTTAT – 3’ and JB4.5 5’ – TAAAGAAAGAACATAATGAAAATG – 3’ for the COI gene (Bowles et al., Reference Bowles, Blair and McManus1992). Polymerase chain reaction was conducted in a T100TM thermocycler (Bio-Rad, California, USA) following the conditions as described in the respective publications. The amplicons (800 bp and 440 bp for the 18S rRNA and COI genes, respectively) were visualized on a 1% agarose gel stained with SYBRTM Safe (Thermo Fisher Scientific, MA, USA). Amplicons were sent for sequencing using the Fast Next Generation Sequencing platform (Tsingke Biotech, Beijing, China).
The electropherograms obtained were checked with BioEdit 7.0 (Hall, Reference Hall1999) and aligned using ClustalX 2.1 (Thompson et al., Reference Thompson, Gibson and Higgin2002) with reference sequences in family Capillariidae obtained from the NCBI database. The aligned sequences were checked in BioEdit 7.0 (Hall, Reference Hall1999), and phylogenetic analysis using the neighbour-joining (NJ) and maximum likelihood (ML) methods was conducted in MEGA X (Kumar et al., Reference Kumar, Stecher, Li, Knyaz and Tamura2018). For the ML method, the best-fit nucleotide substitution model with 1000 bootstrap iterations for tree topology support was used. Trichuris trichiura was used as the outgroup to root the phylogenetic trees. Genetic distance was calculated using the p-distance model in MEGA X (Kumar et al., Reference Kumar, Stecher, Li, Knyaz and Tamura2018).
Results
Taxonomy
Phylum: Nematoda Diesing, 1861
Class: Enoplea Inglis, 1983
Order: Trichocephalida Hall, 1916
Family: Capillariidae Railliet, 1915
Genus: Capillaria Moravec, 1987
Species: Capillaria (Procapillaria) nubthaiensis Chan, 2025 (Figures 1 and 2; Table 1)
Capillaria nubthaiensis sp. nov.: (A) anterior end of male, lateral view; (B) stichocyte at middle region of stichosome; (C) cephalic end, apical view (based on SEM); (D) lateral bacillary band at oesophageal region; (E) vulva region, lateral view; (F) posterior end of female; (G) fully developed egg; (H) spicule; (I, J) caudal end of male, ventral and lateral view, where the papillae near the cloaca was visible using SEM. (AN, anus; IN, intestine; MO, muscular oesophagus; NR, nerve ring; PP, polar plug; SP, spicule; SS, spicule sheath; ST, stichosome; VU, vulva).
Scanning electron microscope images of Capillaria nubthaiensis sp. nov. showing (A) apical view of head, lips, and cephalic papillae (6 papillae on one lip indicated by white arrows) of the male specimen, (B) lateral view of head showing elevated lips of the male specimen, (C) transverse striations and lateral bacillary band in the middle part of body of the female specimen, (D) slightly protruding female vulva appendage, (E) caudal end of female, (F) caudal end of male, (G) caudal end of male with small papillae near anus and (H) spinous spicule sheath.
Comparison between other species of Capillaria (Procapillaria) found in marine fishes (all values are in µm)
NA indicates no information available.
Type host: Scomberomorus commerson Lacepède, 1800
Type locality: Chon Buri, Thailand
Type material: Holotype and allotype deposited at the Mahidol University Museum of Natural History (Voucher no: MUMNH-NEM0036–0037)
Collection date: July 2024 to April 2025.
Parasite prevalence and intensity: 20% prevalence, 5–272 (average 75) nematodes from four positive hosts
Site in host: Intestine
ZooBank LSID: urn:lsid:zoobank.org:pub:5F1509D4-314E-4232-9314-5B3D735303D7
Etymology: The name ‘nubthaiensis’ combines the word ‘nubble’ to signify the slightly protruding (knob-shaped) appendage of the female vulva, ‘Thailand’ to indicate that this nematode was found in the host in the Gulf of Thailand, and the suffix ‘ensis’ signifying its origin.
General description
Thin, small-sized, filariform nematodes with finely transversely striated cuticle. Two inconspicuous lateral bacillary bands extend along the body. Oral aperture terminal, with 2 elevated lips at the mouth opening (Figure 2B). Stylet absent. Mouth surrounded by 12 cephalic papillae arranged in two circles, with 6 papillae on each lip (Figures 1C, 2A). Muscular oesophagus long and narrow (Figure 1A). Stichosome containing a single row of approximately 40–50 elongate stichocytes, with numerous transverse annuli (Figure 1B). Nerve ring encircling muscular oesophagus situated at approximately one-fourth of its length. Two wing-like glandular cells at the level of oesophago-intestinal junction.
Male (based on 30 specimens, average in parentheses)
Body length 7459.04–13 009.83 (10 402.94); maximum width 37.00–62.00 (47.71). Length of entire oesophagus 3344.67–5720.36 (4839.41), representing an average of 46% body length. Length of muscular oesophagus 337.34–584.00 (439.32), of stichosome 3007.34–5365.63 (4400.09); number of stichocytes approximately 46. Nerve ring situated 95.00–126.00 (111.67) from anterior end. Spicule well sclerotized, measuring 343.00–479.00 (413.53) in length, representing an average of 4% body length; proximal end of spicule blunt, 7.80–19.54 (13.50) wide; width of middle part of spicule 18.00–32.50 (22.08), distal end narrow, round. Rough transverse grooves present on almost the entire surface of spicule (Figure 1H). Spicule sheath spiny, with pointed peaks, spines about 2–3 long (Figures 1I, 1J, 2H). Posterior end of body rounded, with a pair of distinct round ventrolateral lobes with a papilla near the base of each lobe (Figures 1I, 1J, 2F). Another pair of small papillae near cloaca (Figure 2G). Cloacal opening subterminal; tail length 16.00–29.00 (22.23).
Female (based on 30 gravid specimens, average in parentheses)
Body length 11 105.10–18 698.33 (15 241.60); maximum width 44.00–75.00 (59.01). Length of entire oesophagus 4096.90–9028.79 (6829.94), representing an average of 44% of body length. Length of muscular oesophagus 293.57–720.78 (446.54), of stichosome 3699.90–8644.06 (6,383.40); number of stichocytes approximately 41. Nerve ring situated 108.00–130.00 (118.97) from anterior end. Vulva located 5096.90–10 028.79 (7893.76) from anterior end of body, representing 51% of body length and situated posterior to level of oesophago-intestinal junction. Vulva lips slightly protruding, forming a knob-like shape (Figures 1E and 2D). Vagina short, muscular. Eggs arranged in single file in uterus. Eggs oval, with protruding polar plugs at both ends (Figure 1G). Egg wall two-layered; inner hyaline layer, outer layer thick. Content of fully developed egg uncleaved. Eggs, including polar plugs, 65.49–76.44 × 23.60–28.79 (72.03 × 25.38); polar plugs 6.20 × 7.40. Caudal end round, anus subterminal (Figures 1F and 2E).
Type materials
Holotype: mature male deposited at the Mahidol University Museum of Natural History (Voucher no.: MUMNH-NEM0036) was collected by Wallop Pakdee and his team, on August 26, 2024, in the intestine of Scomberomorus commerson (ID no: IS-07), at the Department of Helminthology, Faculty of Tropical Medicine, Mahidol University.
Description of holotype: Body length 10 095.24; maximum width 45.00. Entire oesophagus 4835.12 long; muscular oesophagus 375.00; stichosome oesophagus 4460.12. Stichosome with a single row of 45 stichocytes. Nerve ring 103.00 from anterior end. Spicule 406.00 long (4.02% of entire body length); proximal end blunt, 12.00 wide, distal end narrow. Spinous spicule sheath. Posterior with a pair of distinct round ventrolateral lobes; papilla near the base of each lobe and another near base of tail. Tail 21.00 long.
Allotype: gravid female deposited at the Mahidol University Museum of Natural History (Voucher no.: MUMNH-NEM0037) was collected by Wallop Pakdee and his team, on August 26, 2024, in the intestine of Scomberomorus commerson (ID no: IS-07), at the Department of Helminthology, Faculty of Tropical Medicine, Mahidol University.
Description of allotype: Body length 15 394.32; maximum width 53.00. Entire oesophagus 7202.58 long; muscular oesophagus 446.00; stichosome oesophagus 6756.58. Stichosome with a single row of 42 stichocytes. Nerve ring 117.00 from anterior end. Vulva lips slightly protruding with a knob-like shape; vulva located 8208.58 from anterior end. Eggs oval, with protruding polar plugs and uncleaved; 70.30 long and 25.60 wide; egg wall two-layered: an inner hyaline and a thicker outer layer.
Molecular and phylogenetic analysis
The partial nuclear 18S rRNA and the mitochondrial COI genes were used for analysis, with the 18S rRNA gene showing distinct differentiation between the novel Capillaria specimens in this study and other reference Capillaria species. The phylogeny revealed the monophyly of genus Capillaria, with Capillaria nubthaiensis sp. nov. forming a sister clade to Capillaria madseni, Capillaria anatis, and Capillaria pudendotecta (Figure 3). A genetic distance of 7.5–9.5 % was obtained between the novel Capillaria species and other capillariids, with similar genetic distances obtained between other Capillaria species (e.g. 7.7% genetic distance between C. pudendotecta and C. madseni).
Maximum likelihood (K2+G) phylogeny of Capillariidae based on the partial nuclear 18S rRNA gene sequences. The asterisks ‘*’ indicate the Capillaria nubthaiensis sp. nov. in this study. Numbers at the nodes are the bootstrap support for ML/NJ. Only bootstrap values >70 are shown. Monophyletic genera are indicated by a ‘continuous’ line while non-monophyletic genera are indicated by a ‘dashed’ line.
Despite the lack of COI gene sequences available for genus Capillaria, the novel Capillaria specimens are genetically different from the other genera within family Capillariidae (Figure 4). Genetic distances between Capillaria and other genera ranged from 17.0% to 23.6%, supporting genus-level distinction. No intra-species variation was observed for both genetic markers.
Maximum likelihood (T3+G) phylogeny of Capillariidae based on the partial mitochondrial COI gene sequences. The asterisks ‘*’ indicate the Capillaria nubthaiensis sp. nov. in this study. Numbers at the nodes are the bootstrap support for ML/NJ. Only bootstrap values >70 are shown. Monophyletic genera are indicated by a ‘continuous’ line while non-monophyletic genera are indicated by a ‘dashed’ line.
Discussion
On exhibiting a stichosome oesophagus with a single row of stichocytes, male caudal end with two lobes without membranous bursa, and a well-sclerotized spicule with a spinous spicule sheath, the specimens obtained from S. commerson belong to Capillaria Moravec, 1987. Moravec (Reference Moravec1987) established four subgenera of Capillaria spp. from fishes: Capillaroides Moravec, 1987, Hepatocapillaria Moravec, 1987, Neocapillaria Moravec, 1987, and Procapillaria Moravec, 1987 (Moravec, Reference Moravec1987). Based on the presence of the slightly protruding female vulva, which forms a ‘knob-like’ shape, highly sclerotized spicule, and the structure of the male caudal end, Capillaria nubthaiensis sp. nov. is classified within subgenus Procapillaria.
Capillaria nubthaiensis sp. nov. is distinct from other species in Procapillaria infecting marine fishes in its unique female vulva morphology, which appears as slightly protruding, resulting in a ‘knob-like’ shape appendage (Table 1; Figures 1E and 2D). Contrarily, C. margolisi exhibits a large bell-shaped appendage at the vulva, while C. schmidti presents a glob-shaped appendage (Arya, Reference Arya1985; Moravec and McDonald, Reference Moravec and McDonald2011). Morphological descriptions of C. gracilis and C. appendigera describe gravid females with a vulva appendage present, with a length of 153 µm (holotype) for C. appendigera, making the appendage substantially longer than the 10–15 µm appendage of C. nubthaiensis sp. nov. (Arai and Smith, Reference Arai and Smith2016; Moravec and Barton, Reference Moravec and Barton2018). Morphological variation was not observed for this distinct character, where the knob-shaped appendage was present in all 30 female C. nubthaiensis sp. nov. specimens. Differences in egg morphology also support the distinction, where the eggs of C. appendigera and C. margolisi exhibit equatorial constriction, whereas no equatorial constriction was observed for C. nubthaiensis sp. nov. (Moravec and McDonald, Reference Moravec and McDonald2011; Moravec and Barton, Reference Moravec and Barton2018).
The male caudal end also provides another clear morphological character. Capillaria nubthaiensis sp. nov. has a small papilla near the base of each lobe, with another pair of small papillae near the cloaca. In comparison, C. appendigera, C. margolisi, and C. schmidti have larger papillae on each lobe (Moravec and McDonald, Reference Moravec and McDonald2011; Arai and Smith, Reference Arai and Smith2016; Moravec and Barton, Reference Moravec and Barton2018). Although the size of papilla for C. gracilis is not described, the presence of large sessile adcloacal papillae at the base of the lobe in C. gracilis differentiates it from the smaller papillae of C. nubthaiensis sp. nov. (Arai and Smith, Reference Arai and Smith2016).
The Gulf of Thailand, located in the South China Sea, is a small semi-enclosed tropical waterbody bordered by Thailand, Cambodia, Vietnam, and Malaysia (Wattayakorn, Reference Wattayakorn and Wolanski2006). Tropical marine environments support high biodiversity, which extends to helminthic fauna. Genus Capillaria is no stranger to tropical waters, where C. hakofugu and C. acanthopgri were found infecting Ostracion immaculatus and Acanthopagrus schlegelii from the Pacific coast (off Japan); C. plectropomi and Capillaria appendigera from Plectropomus leopardus and Pristipomoides multidens in the waters off Australia and New Caledonia; and C. schimidti from Raja radiata in the Indian Ocean (Arya, Reference Arya1985; Araki and Machida, Reference Araki and Machida1991; Moravec et al., Reference Moravec, Nagasawa and Madinabeitia2010; Moravec and Justine, Reference Moravec and Justine2014; Moravec and Barton, Reference Moravec and Barton2018). The life cycle of Capillaria may be direct or indirect, infecting both marine and terrestrial hosts. Species with terrestrial hosts use fish as intermediate hosts, while species with fish as the final host may use invertebrates (e.g. C. gracillis) (Køie and Nylund, Reference Køie and Nylund2012). With S. commerson as the final host of C. nubthaiensis sp. nov., it is likely that its life cycle involves marine invertebrates, crustaceans, or other fishes as intermediate hosts.
The distribution of S. commerson ranges across tropical Indo-Pacific waters, from Southeast Asia to the Pacific Ocean and the Indian Ocean (Lucena-Frédou et al., Reference Lucena-Frédou, Lima and Frédou2022). Commonly caught and sold at local markets in Thailand and other Southeast Asian countries, S. commerson is economically valuable. Additionally, as a predatory species, S. commerson plays a significant role in maintaining balance within the marine food web. However, environmental pressures and anthropogenic stressors such as ocean warming, pollution, and intensified fishing may threaten their population in the Gulf of Thailand (Nguyen and Vang, Reference Nguyen and Vang2017). These factors may consequently impact the helminth fauna of marine fishes, emphasizing the importance of helminth conservation and conducting surveys in marine environments.
Alongside morphological and host differences, molecular phylogenies using the partial nuclear 18S rRNA and mitochondrial COI genes further support C. nubthaiensis sp. nov. as a novel species. The integration of molecular information in the taxonomy of Capillariidae is vital, with challenges in utilizing morphological characters for identification (Borba et al., Reference Borba, Machado-Silva, Le Bailly and Iñiguez2019). The addition of morphological and molecular information for C. nubthaiensis sp. nov. facilitates accurate identification and aids in efforts to resolve taxonomic complications within Capillariidae.
In conclusion, the discovery of C. nubthaiensis sp. nov. in the Gulf of Thailand contributes valuable information on the taxonomy of Capillaria in marine fishes and expands the known nematode fauna of Thailand. The novel capillariid represents the first species recorded in Thailand’s marine waters and the first reported to infect the narrow-barred Spanish mackerel. In a rapidly changing marine environment, these findings are significant, offering insights into the helminth diversity of Thailand’s marine waters. Through enhancing the current understanding of Capillaria’s distribution and diversity, we shed light on a neglected but nonetheless significant group of nematodes infecting marine fishes.
Supplementary material
The supplementary material for this article can be found at https://doi.org/10.1017/S0031182026101541.
Data availability
All data generated or analysed during this study are included in the published article and its supplementary files. The 18S rRNA and COI gene sequences are in the NCBI database under the accession numbers PV911624 – PV911625 and PV910500 – PV910501, respectively.
Acknowledgements
We acknowledge the Department of Helminthology, Faculty of Tropical Medicine, Mahidol University, Bangkok, for technical support.
Author contribution
AC performed formal analysis, methodology, investigation, writing – original draft and writing – review and editing. UT performed conceptualization, investigation and writing – review and editing. CK performed methodology, investigation and writing – review and editing. VC performed methodology, investigation and writing – review and editing. SA and TK performed methodology and writing – review and editing. WP performed conceptualization, investigation, methodology and writing – review and editing.
All authors read and approved of the final manuscript.
Financial support
This research received no specific grant from any funding agency, commercial or not-for-profit sectors.
Competing interests
The authors declare there are no conflicts of interest.
Ethical standards
Ethical clearance was provided by the Animal Care and Use Committee, Faculty of Tropical Medicine, Mahidol University, Bangkok (No. FTM-ACUC 019/2024E).
Open access
